A second cohort of WT and Il-10-/- mice were used to investigate the impact of IL-10 deficiency on gene expression within the HPA axis following AIA. 6 mice of each genotype received AIA injections. Mice were euthanized by cervical dislocation 3 days post-AIA and the hypothalamus, pituitary and adrenal cortex were rapidly dissected and placed into RNAlater (Ambion) to inactivate RNAses. Following an overnight incubation at 4°C, tissues in RNAlater were transferred to a -80°C freezer for storage until RNA extraction. Total RNA was extracted from dissected tissues using the RNeasy lipid extraction kit (Qiagen, UK).
Rneasy lipid extraction kit
Manufactured by Qiagen
Sourced in United Kingdom
The RNeasy Lipid Extraction Kit is a laboratory tool designed to purify RNA from lipid-rich samples, such as adipose tissue, brain, and nervous system samples. The kit utilizes a guanidine-based lysis buffer and a silica-membrane-based purification method to efficiently extract and isolate high-quality RNA from these types of samples.
Automatically generated - may contain errors
Lab products found in correlation
Rnalater, by Thermo Fisher Scientific (2 mentions)
Quantstudio 7 flex system, by Thermo Fisher Scientific (1 mentions)
Hight capacity cdna reverse transcription kit with rnase inhibitor, by Thermo Fisher Scientific (1 mentions)
Taqman universal master mix 2x, by Thermo Fisher Scientific (1 mentions)
Taqman assay, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Qiagen (1 mentions)
Taqman primer probe set, by Thermo Fisher Scientific (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000c uv vis spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 3 polymerase, by Thermo Fisher Scientific (1 mentions)
Abi prism 7900 sequence detection system, by Thermo Fisher Scientific (1 mentions)
5 protocols using rneasy lipid extraction kit
1
IL-10 Deficiency and HPA Axis
2
Quantitative PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Qiagen RNeasy Lipid extraction kit following manufacturer’s instructions. Total RNA was treated with DNase I (Qiagen) at 37 °C for 30 min, followed by inactivation at 75 °C for 5 min. Reverse-transcription quantitative PCR assays were performed using an Applied Biosystems QuantStudio 7 Flex System. Total RNA (1 μg) was reverse transcribed with random hexamers using Hight-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, ThermoFisher Scientific) following the manufacturer’s protocol. Gene expression levels were determined with the Taqman Universal Master mix (2x) using Taqman assays (Applied Biosystems). The 18S transcript was used as an internal control to normalize the variations for RNA amounts. Gene expression levels are expressed relative to 18S mRNA levels. All primers used in this study were provided by Thermofisher.
3
Quantitative RT-PCR for Viral Biomarkers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared with an RNeasy lipid extraction kit (Qiagen) and quantified with a NanoDrop 2000c UV-Vis spectrophotometer (Thermo Fisher Scientific). A 25-μg portion of total RNA was reverse transcribed to cDNA using a High-Capacity RNA-to-cDNA kit (Applied Biosystems). Relative gene expression was determined using 1 ng RNA, TaqMan Fast Universal PCR master mix (Applied Biosystems), and appropriate TaqMan primer/probe sets (Applied Biosystems). RNA expression relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was normalized to the same RNA loading control used in all batches assayed.
TaqMan primers and probes used included the following: SIV gag forward primer sequence, CAATTTTACCCAGGCATTTAATGTT; SIV gag reverse primer sequence, GCAGAGGAGGAAATTACCCAGTAC; SIV gag probe, 6-carboxyfluorescein (FAM)-TGTCCACCTGCCATTAAGCCCGA-6-carboxytetramethylrhodamine (TAMRA) (63 (link)). The assays used for type I IFN genes were Rh02915441_g1 for ISG15, Rh00895608_m1 for MX1, and Rh04256335_s1 for IFNA2; for the type II gene IFNG, assay Rh02621721_m1 was used. Rh00909240_m1 was used for the astrocyte marker GFAP, and Rh02621745_g1 was used for GAPDH. All inflammatory marker and GAPDH probes were from Thermo Fisher Scientific.
TaqMan primers and probes used included the following: SIV gag forward primer sequence, CAATTTTACCCAGGCATTTAATGTT; SIV gag reverse primer sequence, GCAGAGGAGGAAATTACCCAGTAC; SIV gag probe, 6-carboxyfluorescein (FAM)-TGTCCACCTGCCATTAAGCCCGA-6-carboxytetramethylrhodamine (TAMRA) (63 (link)). The assays used for type I IFN genes were Rh02915441_g1 for ISG15, Rh00895608_m1 for MX1, and Rh04256335_s1 for IFNA2; for the type II gene IFNG, assay Rh02621721_m1 was used. Rh00909240_m1 was used for the astrocyte marker GFAP, and Rh02621745_g1 was used for GAPDH. All inflammatory marker and GAPDH probes were from Thermo Fisher Scientific.
4
IL-10 Deficiency and HPA Axis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A second cohort of WT and Il-10-/- mice were used to investigate the impact of IL-10 deficiency on gene expression within the HPA axis following AIA. 6 mice of each genotype received AIA injections. Mice were euthanized by cervical dislocation 3 days post-AIA and the hypothalamus, pituitary and adrenal cortex were rapidly dissected and placed into RNAlater (Ambion) to inactivate RNAses. Following an overnight incubation at 4°C, tissues in RNAlater were transferred to a -80°C freezer for storage until RNA extraction. Total RNA was extracted from dissected tissues using the RNeasy lipid extraction kit (Qiagen, UK).
5
Quantifying Glut1 and HXK2 Expression in Mouse B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from mouse primary B cells was extracted with an RNeasy lipid extraction kit (Qiagen, Gaithersburg, MD) and cDNA synthesized using SuperScript III polymerase (Invitrogen). RT-PCR was performed on an ABI PRISM 7900 Sequence Detection System (Applied Biosystems, Grand Island, NY). Primers were purchased from Applied Biosystems (Mm00441480_m1 for Glut1 and Mm00443385_m1 for HXK2). Expression data were analyzed using the comparative Ct method43 (link) and normalized to GAPDH expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!