Tetramethylethylenediamine temed

Manufactured by Merck Group

Sourced in United States, Italy

Tetramethylethylenediamine (TEMED) is a chemical compound primarily used as a polymerization catalyst in various laboratory applications, including gel electrophoresis and Western blotting. It functions by accelerating the rate of polymerization of acrylamide and related monomers.

Automatically generated - may contain errors

Lab products found in correlation

Ammonium persulfate ap, by Merck Group (7 mentions) Ammonium persulfate, by Merck Group (6 mentions) Acrylamide, by Merck Group (3 mentions) Sodium dodecyl sulfate (sds), by Merck Group (3 mentions) Stains all, by Merck Group (2 mentions) Acrylamide bis acrylamide 19 1 40 solution, by Avantor (2 mentions) Unmodified tba, by Biomers (2 mentions) Potassium persulfate k2s2o8, by Merck Group (2 mentions) Bis acrylamide, by Merck Group (2 mentions) Urea, by Avantor (1 mentions) Nuclease free water, by Avantor (1 mentions) Fetal bovine serum (fbs), by Euroclone (1 mentions) Bovine serum albumin (bsa), by Thermo Fisher Scientific (1 mentions) Acrylamide, by Avantor (1 mentions) Gelgreen nucleic acid stain, by Avantor (1 mentions) Bromophenol blue, by Avantor (1 mentions) Orange dna loading dye, by Avantor (1 mentions) Tris borate edta 10x, by Avantor (1 mentions) 3 mercaptopropionic acid mpa, by Merck Group (1 mentions) Sodium borohydride nabh4, by Thermo Fisher Scientific (1 mentions)

17 protocols using tetramethylethylenediamine temed

Characterization of Thrombin-Binding Aptamer Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

All the reagents and solvents were of the highest commercially available quality and were used as received. Nuclease-free water, acrylamide/bis-acrylamide (19:1) 40% solution, Tris-Borate-EDTA (TBE) 10×, glycerol formamide and urea were purchased from VWR. Stains-All, ammonium persulfate (APS) and tetramethylethylenediamine (TEMED) were purchased from Sigma Aldrich (Merck Life Science S.r.l., Milan, Italy). Fetal bovine serum (FBS) was provided by Euroclone (Milan, Italy).
Among the oligonucleotides studied, unmodified TBA was purchased from biomers.net GmbH (Ulm/Donau, Germany) as HPLC-purified oligomers. Their identity and purity were proved by MALDI-TOF mass spectrometry and high-performance liquid chromatography (HPLC) data, as provided by the commercial suppliers. All the TBA analogues investigated were synthesized and purified as described below. The purity of all the oligonucleotides was further confirmed by denaturing 20% PAGE analysis.

Pérez de Carvasal K., Riccardi C., Russo Krauss I., Cavasso D., Vasseur J.J., Smietana M., Morvan F, & Montesarchio D. (2021). Charge-Transfer Interactions Stabilize G-Quadruplex-Forming Thrombin Binding Aptamers and Can Improve Their Anticoagulant Activity. International Journal of Molecular Sciences, 22(17), 9510.

+ Open protocol

+ Expand

Oligonucleotide Characterization and Preparation for Biological Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

All the reagents and solvents were of the highest commercially available quality and were used as received. Acrylamide, GelGreen Nucleic Acid Stain, Bromophenol blue (BPB), Gel Loading Buffer 4X, 6X Orange DNA Loading Dye and Tris-Borate-EDTA (TBE) 10X were purchased from VWR. Ammonium persulfate (APS) and tetramethylethylenediamine (TEMED) were purchased from Sigma Aldrich. All the oligonucleotides here studied (Table 1) were purchased from biomers.net GmbH (Ulm, Germany), as HPLC-purified oligomers:

▪

V7t1 (^5′TGTGGGGGTGGACGGGCCGGGTAGA^3′);

▪

bisV7t1T7 (^5′V7t1^3′TTTTTTT^5′V7t1^3′);

▪

bisV7t1HEG2 (^5′V7t1^3′C₂₄H₅₁O₂₀P₃^5′V7t1^3′);

▪

bisV7t1TEG2D (^5′V7t1^3′C₂₅H₅₃N₂O₂₄P₅^3′V7t1^5′).

Evidence of the oligonucleotide identity and purity was obtained by MALDI-TOF mass spectrometry and HPLC data, provided by the commercial suppliers. The purity of these oligonucleotides was further confirmed by denaturing 20% PAGE analysis.
The 24-mer sequence (^5′TCACACACACACACACACACACTT^3′), used as negative oligonucleotide control in the MTT assays, was obtained as reported in previous works [63 (link),64 (link)].
Recombinant human VEGF₁₆₅ (GenScript) was purchased from TwinHelix srl (Milan, Italy) and prepared according to the manufacturer’s instructions.
Bovine serum albumin (BSA) was purchased from Thermo Scientific™ (Waltham, MA, USA).

Riccardi C., Musumeci D., Platella C., Gaglione R., Arciello A, & Montesarchio D. (2020). Tuning the Polymorphism of the Anti-VEGF G-rich V7t1 Aptamer by Covalent Dimeric Constructs. International Journal of Molecular Sciences, 21(6), 1963.

+ Open protocol

+ Expand

Fabrication of Functionalized Nanoparticles and Hydrogels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Phospholipids including hydrogenated l-α-phosphatidylcholine (EggPC), 1,2-di-(9Z-octadecenoyl)-3-trimethylammonium propane (DOTAP), and 1, 2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-lissamine rhodamine B sulfonyl (DMPE-RhB) were purchased from Avanti Polar Lipids, Inc. To prepare carboxyl-functionalized gold nanoparticles (AuC), the following chemicals were purchased: hydrogen tetrachloroaurate (HAuCl₄) (ACROS Organics), sodium borohydride (NaBH₄) (ACROS Organics), and 3-mercaptopropionic acid (MPA, Sigma-Aldrich). To prepare hydrogel, acrylamide (used as the monomer), poly(ethylene glycol) dimethacrylate, (PEGDMA, used as the cross-linker), tetramethylethylene diamine (TEMED) and ammonium persulfate (both used as initiators) were purchased from Sigma-Aldrich. Potassium hydrogen phthalate and potassium phosphate monobasic were purchased from EMD and Sigma Aldrich, respectively, in order to prepare buffer solutions.

Gao W., Vecchio D., Li J., Zhu J., Zhang Q., Fu V., Li J., Thamphiwatana S., Lu D, & Zhang L. (2014). Hydrogel Containing Nanoparticle-Stabilized Liposomes for Topical Antimicrobial Delivery. ACS Nano, 8(3), 2900-2907.

+ Open protocol

+ Expand

Nucleic Acids and Protein Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following reagents were used in this study for the successive extraction of nucleic acids and proteins: RPMI 1640 (HyClone), penicillin-streptomycin (10000 units/mL penicillin and 10000 μg/mL streptomycin; Invitrogen), HEPES (Sigma, United States), fetal bovine serum (FBS; Sijiqing, China), RNAzol (Cohen-Bio Corp., Beijing, China, lot no. NA6111), sodium dodecyl sulfate (SDS; Amresco), agarose (Fluka, Spain), diethyl pyrocarbonate (DEPC; Sigma), acrylamide (BBI, Canada), bis-acrylamide (BBI), tetramethylethylenediamine (TEMED; Sigma), ammonium persulfate (Sigma,), guanidine hydrochloride (BBI, Canada), Tris (Sigma), glycine (Sigma), ethidium bromide (E.B; Sigma), MOPS (Serva, Sino-American Biotechnology Co.), PRO-STAIN^TM protein marker II (SBS Genetech Co., Beijing, China), horseradish peroxidase-anti-glyceraldehyde-3-phosphate dehydrogenase (HRP-anti-GAPDH; Kangchen Bio-tech, Shanghai, China), and sediment type mono-ingredient TMB substrate solution (PA108-01, Tiangen Biotech Co., Beijing, China).

, & Cui Y.Y. (2023). Sequential extraction of RNA, DNA and protein from cultured cells of the same group. World Journal of Methodology, 13(5), 484-491.

+ Open protocol

+ Expand

Thermosensitive Chitosan Hydrogel Fabrication

Check if the same lab product or an alternative is used in the 5 most similar protocols

N-isopropylacrylamide (NIPAM) (97% purity), methylene-bis-acrylamide (MBA), chitosan from shrimp shell (molecular weight 190–310 kDa, deacetylation rate 75–85%), glacial acetic acid, ammonium persulfate (APS), and tetramethylethylenediamine (TEMED) were obtained from Sigma Aldrich (Overijse, Belgium). Calcein AM, ethidium homodimer, phosphate buffered saline (PBS), Gibco minimum essential alpha medium, gibco antibiotic-antimycotic, and Biowest fetal bovine serum (FBS) were obtained from ThermoFisher Scientific (Merelbeke, Belgium).

Salar Amoli M., Anand R., EzEldeen M., Geris L., Jacobs R, & Bloemen V. (2024). Development of 3D Printed pNIPAM-Chitosan Scaffolds for Dentoalveolar Tissue Engineering. Gels, 10(2), 140.

+ Open protocol

+ Expand

Radical ABTS Antioxidant Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The radical ABTS (2,2′-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid)), Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid), Folin-Ciocalteau reagent 1N, gallic acid, and potassium persulfate (K₂S₂O₈) were purchased from Sigma–Aldrich (Steinheim, Germany). The Gram color kit containing crystal violet, Lugol PVP, safranin, and decolorizing solution was purchased from Liofilchem Bacteriology Products (Roseto, Italy). Anaerocult^® anaerobic environment system was purchased from Merck (Darmstadt, Germany). The enzyme ammonium persulfate (APS) and tetramethylethylenediamine (TEMED) catalyst used for the polymerization of polyacrylamide gels were obtained from Sigma-Aldrich (St. Louis, USA). Acetonitrile and dithiothreitol (DTT) were purchased from VWR (Leuven, Belgium). The molecular weight pattern 10−250 kDa was obtained from BioRad (Hercules, California). Ethanol 96° was purchased from GUINAMA S. L. U. (Valencia, Spain).

Martí-Quijal F.J., Tornos A., Príncep A., Luz C., Meca G., Tedeschi P., Ruiz M.J, & Barba F.J. (2020). Impact of Fermentation on the Recovery of Antioxidant Bioactive Compounds from Sea Bass Byproducts. Antioxidants, 9(3), 239.

+ Open protocol

+ Expand

Thrombin Binding Aptamer Characterization

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human D-Phe-Pro-Arg-chloromethylketone (PPACK)-inhibited thrombin was purchased from Haematologic Technologies (USA). Unmodified TBA was purchased from biomers.net GmbH (Ulm/Donau, Germany) as HPLC-purified oligomer. Its identity and purity were proved by MALDI-TOF mass spectrometry and HPLC data, as provided by the commercial supplier. TBA-NNp/DDp was synthesized as previously reported.³⁶ (link) The concentration of the protein and the oligonucleotides was determined by means of UV spectroscopy analysis at 280 nm (at 20°C) and 260 nm (at 90°C), respectively, using molar extinction coefficients calculated from the primary sequences. Prior to each experiment, the aptamer samples were annealed in 10 mM potassium phosphate buffer pH 7.4 and 100 mM KCl by heating to 90°C for 5 min, then slowly cooling down in 50–60 min, and storing at 20°C overnight.
Acrylamide/bis-acrylamide (19:1) 40% solution and glycerol were purchased from VWR. Stains-All, ammonium persulfate (APS), and tetramethylethylenediamine (TEMED) were purchased from Sigma-Aldrich (Merck Life Science S.r.l., Milan, Italy).

Troisi R., Riccardi C., Pérez de Carvasal K., Smietana M., Morvan F., Del Vecchio P., Montesarchio D, & Sica F. (2022). A terminal functionalization strategy reveals unusual binding abilities of anti-thrombin anticoagulant aptamers. Molecular Therapy. Nucleic Acids, 30, 585-594.

+ Open protocol

+ Expand

Synthesis and Characterization of Polyelectrolyte Hydrogels

Check if the same lab product or an alternative is used in the 5 most similar protocols

The chemicals, which were mainly
used in this work are as follows AAm (Sigma-Aldrich, Germany), AAc
(Scharlab, Spain), 2-methacryloyloxy ethyl dimethyl-3-sulfopropyl
ammonium hydroxide (MEDSA) (Sigma-Aldrich, Germany), 2-acrylamido-2-methylpropane
sulfonic acid (AMPS) (Sigma-Aldrich, Germany), BIS (Acros Organics,
USA), KPS (Acros Organics, USA), tetramethylethylenediamine (TEMED)
(Sigma-Aldrich, Germany), iron trichloride (FeCl₃) (Sigma-Aldrich,
Germany), mercuric chloride (HgCl₂) (Sigma-Aldrich, Germany),
and chromium(III) nitrate (Cr(NO₃)₃) (Sigma-Aldrich,
Germany). Analytical standard chemicals and reagents were directly
used without further purification. Deionized water was used as a solvent,
unless otherwise stated, to prepare most of the solutions.

Chowdhury N., S.o.l.a.i.m.a.n., Roy C.K., Firoz S.H., Foyez T, & Imran A.B. (2020). Role of Ionic Moieties in Hydrogel Networks to Remove Heavy Metal Ions from Water. ACS Omega, 6(1), 836-844.

+ Open protocol

+ Expand

Hydrogel Synthesis from HPMC and Acrylic Acid

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hydroxypropyl methyl cellulose (HPMC) powder (composition: hydroxypropoxy content ~9%, viscosity: ~15 mPa.s for 2% (w/w) polymer in H₂O at 25 °C), acrylic acid (AAc, 99%), N,N′-methylenebisacrylamide (MBA, 99%), tetramethylethylenediamine (TEMED, 99%) and potassium persulfate (K₂S₂O₈, 99%) were purchased from Sigma-Aldrich, Sydney, Australia.

Nassar N., Whitehead F., Istivan T., Shanks R, & Kasapis S. (2021). Manipulation of the Glass Transition Properties of a High-Solid System Made of Acrylic Acid-N,N′-Methylenebisacrylamide Copolymer Grafted on Hydroxypropyl Methyl Cellulose. International Journal of Molecular Sciences, 22(5), 2682.

+ Open protocol

+ Expand

DF Compound Extraction and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chloral hydrate, sodium chloride injection, normal saline, and methanol were bought from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Glycine, TRIS buffer, and sodium dodecyl sulfate (SDS) was purchased from Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). Skim milk powder was purchased from BBI Life Sciences (Shanghai, China). 30% acrylamide and ammonium persulfate (AP) were bought from Beijing Dingguo Changsheng Biotechnology Co., Ltd. (Beijing, China). Tetramethylethylenediamine (TEMED) was provided by Sigma (St. Louis, MO, United States). GeneView (Ste. Genevieve, MO, United States) provided the enhanced chemiluminescence (ECL) Kit. The Milli-Q (18.2 MΩ) ultra-pure water system (Millipore, Billerica, MA, United States) was used to prepare pure water. Mouse serum interferon gamma (IFN-γ), IL-10, IL-12p70, IL-17A, TNF-α, IL-6, monocyte chemoattractant protein-1 (MCP1), and IL-1β enzyme-linked immunosorbent assay (ELISA) kits were purchased from Bender (Gruenberg, Germany).
DF was prepared in our laboratory [Batch No.: 20180522. The DF had a rhodojaponin III content of 41.6% and a rhodojaponin VI content of 13.6%, as determined by the linear curve method (Yao et al., 2019 )]. Dexamethasone was purchased from GlpBio (Batch No.: GC40775. Montclair, CA, United States).

Qin J., Zheng X., He Y., Hong Y., Liang S, & Fang X. (2022). The regulation of T helper cell polarization by the diterpenoid fraction of Rhododendron molle based on the JAK/STAT signaling pathway. Frontiers in Pharmacology, 13, 1039441.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!