Puromycin

ROR2 knockout in PANC1 and UM5 cells was induced by using the eSpCas9-LentiCRISPRv2 vector system [78 (link)] containing the following guide RNA sequences: ROR2 guide-RNA (gRNA) 1 (AGCCGCGGCGGATCATCATC), ROR2 gRNA 2 (ATGAAGACCATTACCGCCAC) or scrambled control gRNA (ACGGAGGCTAAGCGTCGCAA). For the generation of lentiviruses, 293FT cells were transfected with the target vector and the packaging plasmids pLP1, pLP2 and pLP/VSVG (Thermo Fisher Scientific) by using Lipofectamine 2000 (11668019, Thermo Fisher Scientific). Lentiviral particles were collected 72 hours after transfection and concentrated by using Lenti-X Concentrator (631231, Takara). After transduction, PANC1 and UM5 cells were constantly kept in cell culture medium containing 5 μg/ml and 2.5 μg/ml Puromycin (P8833, Millipore Sigma), respectively. ROR2 knockout was confirmed by Western Blot.
For overexpression of ROR2, pLV[Exp]-EGFP:T2A:Puro-EF1A>hROR2 (VB900004–2980bun, VectorBuilder) or control vector pLV[Exp]-EGFP/Puro-EF1A>ORF_stuffer, (VB900021–9574dpn, VectorBuilder) were packaged into lentiviral particles, concentrated supernatant was added to HPAF-II and UM32 cells and cells were selected with Puromycin.

Lentiviral constructs with gRNA targeting mouse Acod1 (5′-GGGCTTCCGATAGAGCTGTG-3′ and 5′-AACGTTGGTATTGAAGTACA-3′), or SCR gRNA (5′-GTGTAGTTCGACCATTCGTG-3′) in the puromycin-selectable pLV-hCas9 vector were purchased from VectorBuilder (Chicago, IL). HEK293T cells were transfected with target DNA along with the packaging vectors psPAX2 and pCMV-VSV-G using Lipofectamine 2000 (Invitrogen). Virus was collected 48h after transfection, filtered through a 0.45 μm filter (EMD Millipore), and used for transduction of PRp cells in the presence of 8 μg mL⁻¹ polybrene. Stable polyclonal populations of cells were selected using 3 μg mL⁻¹ puromycin (Invitrogen).

Scrambled control (shControl) and HSP90 knockdown (shHSP90) DU145 and C4-2 cell lines were created using lentiviral based transduction and selection with puromycin, shRNA for HSP90ab were purchased from Santa Cruz Biotechnology, Inc. (HSP90ab# sc-35608-V and Control shRNA# sc-108080). shRNA for HSP90aa were purchased from VectorBuilder Inc. The sequences for HSP90aa and Scramble shRNA are

pLV[shRNA]-EGFP:T2A:Puro-U6 > hHSP90AA1[shRNA#1] shRNA sequence: AGCTGCATATTAACCTTATAC

pLV[shRNA]-EGFP:T2A:Puro-U6 > Scramble[shRNA#1] shRNA sequence: CCTAAGGTTAAGTCGCCCTCG.

Both cell lines were transduced with shRNA-HSP90ab and selected using puromycin (1.5-2 μg/mL). Stable shHSP90ab cells were used for secondary transduction using shRNA-HSP90aa. Secondary transduced cells were selected using cell sorting for EGFP markers. Dual knockdowns, HSP90aa and shHSP90ab (shHSP90) were confirmed using western blotting.