Axiocam 105 color digital camera

Manufactured by Zeiss

Sourced in Germany

The Axiocam 105 color digital camera is a high-performance image acquisition device designed for microscopy applications. It features a 5-megapixel CMOS sensor that captures detailed, color-accurate images. The camera is capable of fast frame rates and supports a wide range of resolutions, making it suitable for various microscopy techniques.

Automatically generated - may contain errors

Lab products found in correlation

Neurobasal medium, by Thermo Fisher Scientific (2 mentions) Usb prepease gel extraction kit, by Thermo Fisher Scientific (1 mentions) Axioskop microscope, by Zeiss (1 mentions) Dig rna labeling kit, by Roche (1 mentions) Axiovert s100 microscope, by Zeiss (1 mentions) Stemi 508 stereo microscope, by Zeiss (1 mentions) L glutamine, by Thermo Fisher Scientific (1 mentions) N2 supplement, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

Axiocam 105 color camera Axiocam color digital camera Axiocam 105 color Axiocam 105 camera Axiocam color camera AxioCam digital camera Axiocam 105 AxioCam digital AxioCam camera Digital camera

5 protocols using axiocam 105 color digital camera

In Situ Hybridization of Klhl14-AS in Mouse Thyroid

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Organs were fixed in 4% PFA (overnight, 4°C), washed in saline solution, dehydrated in solutions at increasing ethanol concentration from 70% to 100% (overnight, 4°C), and paraffin-embedded at 60°C after xylene soaking. The period of each step is determined according to the size of the processed sample.
Paraffin-embedded samples were sliced in 7 μm sections and analyzed. To perform the in situ hybridization, the sections were deparaffinized in xylene and rehydrated with EtOH 100% to EtOH 50%. After rehydration, the hybridization was performed as described in Fagman et al. [21 (link)], using a specific probe for Klhl14-AS amplified with Pwo SuperYield DNA Polymerase from adult mouse thyroid cDNA using the following oligos—Klhl14-AS sp6: GGCTGAACAGGAAGGGACCCT and Klhl14-AS T7: CAGATCACAGCTAAGAAAAAAGC.
PCR product was purified using the USB® PrepEase® Gel Extraction Kit (Affymetrix 78756). Digoxigenin-labelled riboprobes (sense and antisense) were obtained using the DIG-labeling RNA kit (Roche Diagnostics Basel, Switzerland) following the manufacturer's instructions. No signal was detected with the sense riboprobes (not shown). Images were obtained using an Axioskop microscope equipped with an Axiocam 105 color digital camera (Zeiss, Oberkochen, Germany). Images were processed using the Axion Vision software.

Credendino S.C., Lewin N., de Oliveira M., Basu S., D'Andrea B., Amendola E., Di Guida L., Nardone A., Sanges R., De Felice M, & De Vita G. (2017). Tissue- and Cell Type-Specific Expression of the Long Noncoding RNA Klhl14-AS in Mouse. International Journal of Genomics, 2017, 9769171.

+ Open protocol

+ Expand

Histological Analysis of Adipose Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

For histological analysis of adipose tissue, frozen visceral adipose tissue (VAT) was formalin fixed, paraffin embedded, sectioned into 5 µm sections, and hematoxylin/eosin stained. The average adipocyte density was determined by measuring the perimeter around 500 adipocytes, from at least 4 different fields, at 200 × magnification. Adipose tissue sections were viewed with an Axiovert S100 microscope (Zeiss, Jena, Germany), equipped with an Axiocam 105 color Digital Camera and the Zen 2 core software version 2.5 (both Zeiss, Jena, Germany). For the measurements ImageJ (NIH, Bethesda, MD, USA) was used.

Graf D., Weitkunat K., Dötsch A., Liebisch G., Döring M., Krüger R., Stoll D., Vatareck E., von Coburg E., Loh G, & Watzl B. (2019). Specific Wheat Fractions Influence Hepatic Fat Metabolism in Diet-Induced Obese Mice. Nutrients, 11(10), 2348.

+ Open protocol

+ Expand

Whole Mount In Situ Hybridization of Embryonic Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Probe template was amplified by PCR from E13.5 head cDNA using the following primers: 5'-GACTCTAGAGATAAGGGTAGGAACCACAC-3' and 5'-GAGAAGCTTGGAATGTTTTACCTGGACTTG-3'. PCR product was cloned into the pBluescript II KS(+) dual promoter (T7 and T3) phagemid vector (Agilent Technologies, Inc.) and standard procedures were followed for the preparation of DIG-labeled cRNA (Roche Diagnostics, Indianapolis, IN, USA) anti-sense (AS) and control sense (S) probes. Whole mount in situ hybridization was performed based on a previously published protocol (Wilkinson, 1998) using 1 µg/mL probe and anti-DIG-AP Fab fragment primary antibody (1:2,000; Roche Diagnostics). Stained embryos were photographed using an Axiocam 105 color digital camera (Carl Zeiss, Inc.) fitted onto a Stemi 508 stereo microscope (Carl Zeiss, Inc.). In situ hybridization experiments were performed simultaneously using anti-sense and sense probes across at least two independent experiments per timepoint.

Dennison B.J.C., Larson E.D., Fu R., Mo J., & Fantauzzo K.A. (2020). Srsf3 mediates alternative RNA splicing downstream of PDGFRα signaling.

+ Open protocol

+ Expand

Anthrax Effects on N2A Cell Morphology

Check if the same lab product or an alternative is used in the 5 most similar protocols

The effect of anthrax on the morphology of N2A cells was examined. In experiments
involving anthrax antibodies to study the effects on cell membrane,
cytoskeletal, and mitochondrial integrity, anti-Anthrax Protective Antigen
(polyclonal antiserum Cat. No. CPBT-66806RA) and monoclonal anti-anthrax
antibody (CABT-51076MA, both from Creative Diagnostics, Shirley, NY, USA) were
used in parallel with similar results. Both antibodies were titrated for effects
at a series of concentrations following preincubation with either anthrax PA63
or GWI serum and used at the lowest active concentration (15% for polyclonal
anti-anthrax antiserum and 5 μg/mL of monoclonal anti-anthrax). Each antibody
was incubated with either anthrax PA63 at 0.5 μg/mL or 100 μL of GWI serum for
60 minutes at 37°C and then added in a final volume of 1 mL of Neurobasal medium
containing N2 supplement and l-glutamine.
The N2A cells were cultured with PA63 (0.5 μg/mL) for 2 days and the cells were
photographed. Images were obtained from 5 to 8 different fields per sample, from
a minimum of 3 experiments using a Motic AE2000-Trinocular inverted microscope
(Ted Pella, Redding, CA, USA), with a Zeiss Axiocam 105 color digital camera
(Carl Zeiss Microscopy, LLC, Thornwood, NY, USA). The extent of cell spreading
was then calculated with ImageJ software by measuring the number of cells with
processes relative to the total cell number.

Tsilibary E.P., Souto E.P., Kratzke M., James L.M., Engdahl B.E, & Georgopoulos A.P. (2020). Anthrax Protective Antigen 63 (PA63): Toxic Effects in Neural Cultures and Role in Gulf War Illness (GWI). Neuroscience Insights, 15, 2633105520931966.

+ Open protocol

+ Expand

Serum Effects on Neuroblastoma Cell Morphology

Check if the same lab product or an alternative is used in the 5 most similar protocols

The effects of serum on cell morphology were assessed in neuroblastoma cells seeded in poly-D-lysine coated, 24-well plates at a concentration of 100,000/well in Neurobasal medium containing N2 supplement and L-glutamine (ThermoFisher Scientific, Waltham, MA), in the absence (medium control) or presence of human serum for up to 5 DIV. Human serum was added in 3 combinations (Table 1A). At day 2 DIV photographs were taken from 5–8 fields of each differently treated well using a Motic AE2000-Trinocular inverted microscope (Ted Pella, Redding, Ca) and a Zeiss Axiocam 105 color digital camera (Carl Zeiss Microscopy, LLC, Thornwood, NY). Cell spreading was calculated using ImageJ software (Image Processing and Analysis in JAVA: https://imagej.nih.gov/ij/) by measuring the number of cells with processes relative to the total cell number.

Georgopoulos A.P., Tsilibary E.P., Souto E.P., James L.M., Engdahl B.E, & Georgopoulos A. (2018). Adverse effects of Gulf War Illness (GWI) serum on neural cultures and their prevention by healthy serum. Journal of neurology & neuromedicine, 3(2), 19-27.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!