Rabbit anti human gapdh monoclonal antibody

For the immunohisto- and cyto-chemistry and wester blotting analyses, the following antibodies were used. The primary antibodies; rabbit anti-human PKM2 monoclonal antibody (#4053), rabbit anti-human E-cadherin monoclonal antibody (#3195), rabbit anti-human N-cadherin polyclonal antibody (#4061), rabbit anti-human ubiquitin polyclonal antibody (#3933), rabbit anti-human histone H3 polyclonal antibody (#9715), rabbit anti-human GAPDH monoclonal antibody (#2118) and mouse anti-human β-actin monoclonal antibody (#3700) were purchased from Cell Signaling Technology Inc. (Danvers, MA, USA). Rabbit anti-human TGIF2 monoclonal antibody (ab155948) and mouse anti-bovine vimentin monoclonal antibody (ab8978) were purchased from abcam (Cambridge, UK). The secondary antibodies; Horseradish peroxidase (HRP)-conjugated polymer anti-rabbit and anti-mouse antibodies were purchased from DAKO-Agilent Technologies Co. (Santa Clara, CA, USA). HRP-linked anti-rabbit and -mouse antibodies were purchased from Cell Signaling Technology Inc. (Danvers, MA, USA). Alexa Fluor 594-conjugated goat anti-rabbit IgG and Alexa Fluor 488-conjugated goat anti-mouse IgG antibodies were purchased from Invitrogen-Thermo Fisher Scientific (Waltham, MA, USA).

The reagents used in this study were Hams F‐12K medium (Wuhan Servicebio), RPMI 1640 medium, and FBS (Gibco). The three groups of LRRC59 interference experimental plasmids with different sequences and one negative control plasmid (Chongqing Baoguang Biotechnology Co., Ltd.) are as follows:
shLRRC59#1:5′‐CCTGGATCTGTCTTGTAATAA‐3′
shLRRC59#2:5′‐GTAATAAACTGACTACTCT‐3′
shLRRC59#3:5′‐GCAGTGTAAGCAGTGTGCAAA‐3′
shLRRC59#NC:5′‐CCTAAGGTTAAGTCGCCCTCG‐3′
Other reagents and instruments included the transfection reagent Lipofectamine3000 (Invitrogen); RNA extraction TRIzol Kit, RNA reverse transcription kit, and quantitative detection kit (TaKaRa); qRT‐PCR primers (Shanghai Sangon Biotech Co., Ltd.); CCK‐8 kit (Chongqing Baoguang Biotechnology Co., Ltd.); transwell cell chamber (Corning); Matrigel (BD); crystal violet staining solution (Chongqing Baoguang Biotechnology Co., Ltd.); rabbit anti‐human LRRC59 polyclonal antibody (ab184143, Abcam); rabbit anti‐human GAPDH monoclonal antibody (2118), and mouse anti‐human β‐actin monoclonal antibody (3700; Cell Signaling Technology); rabbit anti‐human E‐cadherin polyclonal antibody (BS72286), rabbit anti‐human Vimentin polyclonal antibody (BS91440), and rabbit anti‐human Snail polyclonal antibody (BS91262; Bioworld Technology).