Sodium chloride (nacl)

The following chemicals were utilized and purchased from commercial sources for preparing the composite for osteosarcoma bone repair: Calcium nitrate tetrahydrate (CaH₈N₂O₁₀), diammonium phosphate [(NH₄)₂HPO₄], cuprous chloride (CuCl), cadmium iodide (CdI₂), PAA [(C₃H₅NO)n], UMB (C₉H₆O₃), and ammonia solution (NH₃); for preparing simulated body fluid (SBF) solution, the required chemicals, such as sodium chloride (NaCl), sodium bicarbonate (NaHCO₃), potassium chloride (KCl), dipotassium hydrogen phosphate (K₂HPO₄), magnesium chloride (MgCl₂), calcium chloride (CaCl₂), 1 M-HCl, sodium sulfate (Na₂SO₄), tris buffer, and sodium hydroxide (NaOH) were purchased from Sisco Research Laboratories Pvt., Ltd., Mumbai, India. The solvents used are ethanol (C₂H₅OH), and methanol (CH₃OH), such as received from Sisco Research Laboratories Pvt., Ltd., Mumbai, India. The complete reaction was carried out through double-distilled (DD) water.

Gold (III) chloride and Aflatoxin M1 (Afl M1) were purchased from Sigma-Aldrich. Sodium citrate and sodium chloride were procured from Sisco Research Laboratories Pvt. Ltd. (SRL), India. The 21-mer aptamer sequence of Afl M1 (ACTGCTAGAGATTTTCCACAT (5′ to 3′)), The Ochratoxin aptamer sequence used was 36-mer 5-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3 and the ssDNA oligonucleotides were synthesized by GCC biotech, India. Stock solutions (100 μM) of aptamers were dissolved in ultrapure water then stored at −20 °C. Whatman filter paper was purchased from GE healthcare, India. Trysulfonium hexaflurophosphate and Propylene glycol monomethyl ether acetate (PGMEA) were procured from Sigma-Aldrich. All reagents were of analytical grade and used as received.

Chemicals conforming to analytical grade were used. Guanosine-5-monophosphate disodium salt (GMP), citric acid anhydrous, l-tryptophan, sucrose, and sodium chloride were procured from Sisco Research Laboratories Pvt. Ltd. (Mumbai, India). Sodium nitrite and acetone were obtained from Sigma-Aldrich (St. Louis, MO, USA). Sodium carbonate was procured from TCI Chemicals Pvt. Ltd. (Tokyo, Japan). Ethanol was obtained from Changshu Hongsheng Fine Chemicals Co. Ltd. (China). All solutions were prepared in Milli-Q water (18.2 MΩ.cm) at room temperature (≈25 °C).
Borosil glass slides measuring 75 mm × 25 mm × 1 mm were used as substrates for inkjet printing. The conductive carbon ink (viscosity: 25,000 cps) was obtained from Engineered Materials Systems, Inc. (EMS) (Delaware, OH, USA). Negative dry film photoresist of 1.5 mil, i.e., 40 µm thickness (RistonPM 240, Dupont, Wilmington, DE, USA), was used for photolithography. The V-One inkjet-printer (Voltera, Kitchener, Canada) and direct laser writing system (HO-LWS-PUV, Holmarc, Kochi, India) were used for fabrication.

Restriction enzymes were purchased from New England Biolabs (NEB), USA. Taq polymerase and T4 DNA ligase were purchased from Bangalore Genei, India. Gel extraction kit and plasmid isolation kit were purchased from Qiagen, India. Recombinant yeast strain P. pastoris X-33 harbouring Lip11 gene from Yarrowia lipolytica was taken from the laboratory culture collection. This strain has been submitted to Microbial Type Culture Collection (MTCC) with MTCC number 9517. Zeocine was from Invitrogen. The triacylglycerides, p-np esters used in the experiments were procured from Sigma Aldrich. Luria bertani, tryptone, yeast extract, yeast nitrogen base and methanol were purchased from Hi-Media. Sodium chloride was taken from Sisco Research Laboratories Pvt. Ltd. India (SRL). Glycosylation kit was procured from G Bioscience (USA).

Gold chloride (HAuCl₄), Aflatoxin B1, OTA, trysulfonium hexafluorophosphate salt, propylene glycol monomethyl ether acetate, and negative photoresist were purchased from Merck, Delhi, India. Sodium citrate and sodium chloride were purchased from Sisco Research Laboratories Pvt. Ltd, Delhi, India. The 36-mer aptamer sequence of OTA was 5′-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3′, and 21-mer aptamer sequence of aflatoxin B1 5′-GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCG CTAGGCCCACA-(3′) was purchased from GCC Biotech (India) Pvt. Ltd, Kolkata, India. Nunc Elisa plates were purchased from ThermoFisher Scientific, Delhi, India. Corn and groundnut samples were purchased from a local supermarket in Hyderabad, India. For HPLC analysis, acetonitrile, water, and acetic acid were purchased at a high purity grade from Merck, Delhi, India. All reagents used for the experiments were of analytical grade.