Pmir report firefly luciferase mirna expression reporter vector

Luciferase reporter assay was performed as previously described^{10 (link)}. The E2F2 3′-UTR has a region that has been predicted to bind to hsa-miR-522-3p. Synthetic oligonucleotides were created with four copies of the E2F2 3′-UTR (GTCTCCACTGGGCTGCCATTTA; bp 1928–1934 of ENST00000361729) or four copies of a mutated version of the sequence (GTCTGCACTGCGCTGCGATATA), as well as with MluΙ and XhoΙ restriction sites at each end. These oligonucleotides were then cloned into the pMIR-REPORT firefly luciferase miRNA expression reporter vector (Applied Biosystems; #AM5795). After 5 × 10⁴ ovarian cancer cells were seeded onto 24-well plates, 0.5 μg of the pMIR-REPORT vector, 0.05 μg of the pRL-TK Renilla luciferase control vector (#E2241; Promega, Madison, WI, USA), and 40 pM of pre-miR-522-3p or the negative control miRNA were co-transfected using Lipofectamine 3000. At 24 h after transfection, luciferase activity was measured using the Dual-Luciferase Reporter Assay System (#E1910; Promega) according to the manufacturer’s instructions. Firefly luciferase activity was normalized to the Renilla luciferase activity.

Synthetic oligonucleotides with 4 copies of the MDM2 3′-UTR (GACCGAGTCTTGCTCTGTTACCC; bp 316–338 of ENST00000462284), which were predicted to bind with hsa-miR-194-5p, or 4 copies of a mutated version of the sequence (GAGCGTGTCTTGCTCTCTTTCCC) with MluΙ and XhoΙ restriction sites at each end, were cloned into the pMIR-REPORT firefly luciferase miRNA expression reporter vector (Applied Biosystems; #AM5795). After 5 × 10⁴ ovarian cancer cells were seeded onto 24-well plates, 0.5 μg of the pMIR-REPORT vector, 0.05 μg of the pRL-TK Renilla luciferase control vector (Promega, Madison, WI, USA; #E2241), and 40 pM pre-miR-194-5p or the negative control miRNA were co-transfected using Lipofectamine 2000. Twenty-four hours after transfection, luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega; #E1910) according to the manufacturer's instructions. Firefly luciferase activities were normalized to Renilla luciferase activities.