Hexadimethrine bromide

Knockout of the CDK1, DGAT1, DGAT2, and RB1 genes in human cell lines was performed using single guide RNAs (sgRNAs) and CRISPR/Cas9 technology. gRNAs were cloned into the lentiviral plasmid lentiCRISPR v2 or lentiGuide_Puro (Addgene). sgCDK1: ‘TACTTTGTTTCAG GTACCTA’, ‘GGGTTCCTAGTACTGCAATT’, ‘CATAAGCACATCCTG AAGAC’; sgDGAT1: ‘TTAGAGGCGCCCACCACACC’, ‘CACCCCCAGGTATGGCATCC’, ‘CAGGATGCCATACC TGGGGG’; sgDGAT2: ‘CGAGTGCGATACCATTCCCA’, ‘TATGCAGGACTGGACCACCT’, ‘CATGTGAACTTGGGACACCC’; sgRB1: ‘GCTCTGGGTCCTCCTCAGGA’, ‘TCGCTCACCT GACGAGAGGC’, ‘TTCATCTGTGGATGGAGTAT’. gRNA clones were transfected into HEK293T cells with psPAX2 packaging plasmid and pMD2.G VSV-G envelope-expressing plasmid as described previously^{35 (link),36 (link)}. Caki-1 cells were infected with lentivirus along with 0.8 μg/ml hexadimethrine bromide (Polybrene; Millipore, #TR-1003-G) and selected with puromycin (2 μg/ml; InvivoGen, #ant-pr-1) for 3 days. For CDK1 knockout, gRNAs were cloned into the lentiGuide-Puro vector (Addgene; #52963). Caki-1 cells carrying doxycycline-inducible Cas9 were cultured with tetracycline-free fetal bovine serum (Takara Bio, #631107) and infected with gRNAs targeting CDK1. doxycycline (1 μg/ml; Sigma, D9891) was added into the media for 3 days to generate CDK1-knockout cells.

sgRNAs were designed to target the family CNV or the CDH1 portion of that CNV using Benchling online platform (supplementary table 3). Individual sgRNAs (Invitrogen) were cloned in LentiCRISPRv2GFP (addgene 82416) or LentiCRISPRv2-mCherry (addgene 99154) vectors using BsmBIv2 (New England Biolabs). Plasmids were transformed into Stbl3 competent cells and colonies were sequenced (supplementary Table 4). Lentiviral particles were produced resourcing to HEK293T cell line with pMD2.G (addgene 12259) and pCMV-dR8.91 (addgene) vectors, following Lipofectamine 3000 manufacture’s protocol (Invitrogen) and collected at 48 h. MKN74 was infected with pairs of lentivirus particles in medium supplemented with 10 μg/μl hexadimethrine bromide (Merck Life Science S.L.U.) for 48 h. Transduced cells were selected for GFP and mCherry positive expression at 7 days post-infection using FACS ARIA (BD Biosciences).

B16-F10 mouse melanoma cells were obtained from ATCC (Cat. No. CRL-6475) and maintained in RPMI 1640-GlutaMAX (Cat. No. 61870-010, Thermo Fisher Scientific), supplemented with heat-inactivated fetal bovine serum (FBS, 10% v/v, Cat. No. 10270-106, Thermo Fisher Scientific) and penicillin/streptomycin solution (100 units/mL penicillin, 100 μg/mL streptomycin, Cat. No. 15070-063, Thermo Fisher Scientific). Cells were routinely tested for mycoplasma contamination by staining with 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, Cat. No. D1306, Thermo Fisher Scientific) followed by visual inspection at the fluorescence microscope. The day before LV infection, cells were plated at 30% confluence into a 35-mm Petri dish. Cells were pre-incubated in complete RPMI medium supplemented with hexadimethrine bromide (16 μg/mL, Cat. No. H9268, Merck KGaA, Darmstadt, Germany) at 37 °C for 30 min, then RPMI was replaced by 0.5 mL of LV-containing supernatant supplemented with hexadimethrine bromide (16 μg/mL). Cells were incubated for 3 h with the LV-containing medium alone to maximize infection efficiency, and then 1.5 mL of fresh culture medium was added to allow the incubation to continue overnight.

Lentivirus production was carried out as previously described (44 (link)). In brief, HEK293T cells were transfected with TransIT-LT1 (Mirus) in a 2:1:1 ratio of the lentiviral vector and psPAX2 and pMD2.G packaging plasmids (Addgene), according to the manufacturer's instructions. Viral supernatant was collected 48 and 72 hours after transfection. The supernatant was pooled, filtered, and stored at –80°C. Neuroblastoma and RPE cells were transduced with virus particles in the presence of 8 μg/mL hexadimethrine bromide (Merck). Cells were transduced for 1 day in antibiotic-free medium and then grown in the full medium for 1 day. Neuroblastoma cells were then selected for 2 days with puromycin hydrochloride (2 μg/mL) or geneticin disulfate (G418, Roth; 2 mg/mL).

VSV-G-based lentiviruses were produced by co-transfecting HEK293T cells with pCMVR8.91, pLAS2-based lentiviral plasmids pLAS2-SARS-CoV-2-N and pLAS2-GFP, and plasmids encoding either SARS-CoV-2 S or VSV-G at ratios of 6.25: 6.5: 1.1 using PEI transfection (PEI MAX, M.W. 40,000, Polysciences 24765-1, Warrington, PA, USA) following the manufacturer’s instructions. Supernatants were collected at 60 h post-transfection, passed through a 0.45-μm filter, and applied for cell transduction with 8 μg/mL hexadimethrine bromide (H9268, Merck, Darmstadt, Germany). Culture supernatants were replenished with fresh medium containing 1 μg/mL puromycin (Invitrogen, Carlsbad, CA, USA) for selecting cells successfully transduced with the indicated lentiviruses.