cDNA synthesis was performed using 1–5 μg of total RNA with random hexamers and reverse transcriptase (GoScript, Promega, Charbonnières-les-Bains, France). Quantitative RT-QPCR was performed in triplicates for each samples using the KAPA SYBR PCR kit (KK4600, Sigma, Saint-Quentin-Fallavier, France) with a LightCycler 480 apparatus (Roche, Basel, Switzerland). 10–100 ng of cDNA was used for each reaction. Primers are listed in Table S2 . Relative expression values were calculated using the 2−ΔΔCT method and normalized using the β-actin gene. All QPCR reactions were performed with three independent cultures.
Lightcycler 480 apparatus
Manufactured by Roche
Sourced in Germany, France, Switzerland, United States
The LightCycler 480 is a real-time PCR instrument designed for high-throughput nucleic acid quantification and genotyping. It features a 96-well plate format and employs fluorescent detection technology to enable sensitive and precise measurements of DNA and RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (4 mentions)
Lightcycler 480 sybr green 1 master, by Roche (3 mentions)
Kapa sybr fast qpcr kit master mix, by Roche (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Kapa sybr pcr kit, by Merck Group (2 mentions)
Random hexanucleotide primer, by Promega (2 mentions)
Moloney murine leukemia virus reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Mmlv first strand synthesis kit, by GeneDireX (2 mentions)
First strand cdna synthesis kit, by Toyobo (2 mentions)
Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Quantitect sybr green pcr kit, by Qiagen (2 mentions)
High pure rna isolation kit, by Roche (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Superreal premix plus, by Tiangen Biotech (2 mentions)
Primer express 3, by Thermo Fisher Scientific (2 mentions)
Rneasy plant mini kit, by Qiagen (2 mentions)
45 protocols using lightcycler 480 apparatus
1
cDNA Synthesis and qRT-PCR Analysis
2
Quantitative Analysis of Immune Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription of total RNA was performed at 37 °C using the Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA) and random hexanucleotide primers (Promega, Madison, WI). Real-time quantitative PCR analyses were performed on a Light Cycler 480 SYBR Green I master and a Light Cycler 480 apparatus (both from Roche Diagnostics, Indianapolis, IN). The PCR product integrity was verified by melting curve analysis. Quantification data were normalized to the amplification data for the reference gene encoding ribosomal protein S9 (RPS9). The sequences of the primers for IL-15, GZMB, PRF1, IFNγ, CD206, F4/80, TGFβ, and RPS9 are presented (Additional file 1 : Table S1).
3
Strand-specific qPCR for ncNAT analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription was performed using the Reverse Aid H Minus kit (LifeTechnologies, Belgium) from 100 ng of total RNA using random hexamer primers in the case of coding genes and using target-specific primers coupled to an unrelated synthetic DNA oligonucleotide in the case of ncNAT.
Quantitative PCR were performed using specific 6-FAM/ZEN/IBFQ probes (IDT, Belgium) with Kapa Probe Fast qPCR Master Mix (Sopachem, Belgium) on a LightCycler 480 apparatus (Roche). In the case of coding gene amplification, the primers were designed according to a standard procedure. In the case of ncNAT gene amplification, a primer specific to the target ncNAT and a primer specific to the synthetic oligonucleotide added during reverse transcription were used to allow strand-specific amplification.
The relative expression was calculated using the standard curves methods, using beta−2-microglobuline as endogenous standard.
Primers and probe sequences can be found in the Supplemental File1 / Additional Materials and Methods.
Quantitative PCR were performed using specific 6-FAM/ZEN/IBFQ probes (IDT, Belgium) with Kapa Probe Fast qPCR Master Mix (Sopachem, Belgium) on a LightCycler 480 apparatus (Roche). In the case of coding gene amplification, the primers were designed according to a standard procedure. In the case of ncNAT gene amplification, a primer specific to the target ncNAT and a primer specific to the synthetic oligonucleotide added during reverse transcription were used to allow strand-specific amplification.
The relative expression was calculated using the standard curves methods, using beta−2-microglobuline as endogenous standard.
Primers and probe sequences can be found in the Supplemental File
4
Quantitative PCR Analysis of Neurosphere Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from neurospheres (Qiagen) and reverse-transcribed (Superscript II, Promega) with random hexamers. Semi-quantitative PCR was performed with 100 ng of cDNA with Taq polymerase (Qiagen) for 30 cycles before gel electrophoresis in the presence of Sybr DNA dye. Quantitative PCR were performed using a Sybr PCR kit (Qiagen) and a LightCycler 480 apparatus (Roche). Primers sequences: OCAM-GPI (CCAAGCAGTGGCAAGAGTTT & GCATTCAGATGCCATGACTG ); OCAM-TM (ATGGGCTACGAAGTGCAAAT & TGGACTCCCATCTTCATGGT ); OCAM for QPCR (GGTGTCCCCTCAAGAGTTCA & GGATGGTGGTGACTTCCTCA ); KI67 (GACTAGAAACCAAGCTGCGG & GCTGAGTTAAAGAGAGCCGC ); ErbB2 (GAGCCTTCGGCACTGTCTAC & ACGTGGTTGGGACTCTTGAC ); β-actin (AGACTTCGAGCAGGAGATGG & GTGCTAGGAGCCAGAGCAGT ); GAPDH (TGTCCGTCGTGGATCTGAC & CCTGCTTCACCACCTTCTTG ).
5
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagent (Invitrogen). RT-PCR was performed using 1 μg of sample and the MMLV First-Strand synthesis kit (GeneDireX), and a ten-fold dilution of the RT-PCR product was applied for qPCR analysis. qPCR was performed using KAPA SYBR® FAST qPCR Master Mix Kit (Kapa Biosystems) by the LightCycler 480 apparatus (Roche). GAPDH served as an endogenous control. Specific DNA expression was estimated by the comparative Ct method using 2−ΔΔCt. Primer information is provided in Supplementary Table 1 .
6
ATRA Regulation of RXRα and RARβ Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCT-116 or HCT-116Sphk2 cells were treated with ATRA (5 μM) for 24 h. Cells were harvested and total RNA was extracted with a Trizol RNA extraction kit (Invitrogen). Reverse transcription was performed with the First Strand cDNA Synthesis kit (Toyobo, Japan). qPCRs assays were performed with the QuantiTect SYBR Green PCR kit (QIAGEN) in a LightCycler 480 apparatus (Roche). Real-time PCR reactions were performed in an ABI 7500 Fast Real-Time PCR System (Applied Biosystems). The primer sequences were: RXRα forward 5′- CTTTGACAGGGTGCTAACAGAGC-3′, reverse 5′-ACGCTTCTAGTGACGCATACACC-3′) [39 (link)]. β-actin forward 5′-GTCACCAACTGGGACGACA-3′, reverse 5′-TGGCCATCTCTTGCTCGAA-3′. RARβ forward 5′-GGAACGCATTCGGAAGGCTT-3′, reverse 5′-GGAAGACGGACTCGCAGTGT-3′; β-actin forward 5′-GTGAAGGTCGGTGTCAACGGATTT-3′, reverse 5′-CACAGTCTTCTGAGTGGCAGTGAT-3′ [40 (link)].
7
Intracellular Viral RNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using a High Pure RNA isolation kit (Roche Diagnostics) according to the manufacturer’s protocol. cDNA was synthesized using the SuperScript III first-strand synthesis system (Invitrogen). The primers for reverse transcription were oligo(dT)20 and IAV-specific RT primer (uni-12, 5′-AGCAAAAGCAGG-3′). Real-time PCR analysis followed the standard TaqMan method with the Universal Probe Library (UPL) system and LightCycler 480 apparatus (Roche Diagnostics). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a control for normalization of cellular RNA and intracellular viral RNA levels. The sequences of primers and probes were as follows: for the IAV NP segment, sense 5′-GATGGAGACTGATGGAGAACG-3′, and antisense, 5′-TCATTTTTCCGACAGATGCTC-3′ with universal probe 59; for CNOT4, sense, 5′-CGGTGGTTTCTTGTGAGGAC-3′, and antisense, 5′-AGCTAAAATGTAGGACTTTGACGAC-3′, with universal probe 21; for GAPDH, sense, 5′-AGCCACATCGCTCAGACAC-3′, and antisense, 5′-GCCCAATACGACCAAATCC-3′ with universal probe 60.
8
qPCR Analysis of Innate Immune Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using TRIzol reagent in accordance with the manufacturer’s guide (Invitrogen). Reverse transcription of total miRNA was performed by using miScript reverse transcription kit (QIAGEN), according to the manufacturer’s protocol. Reverse transcribed with First Strand cDNA Synthesis kit (Toyobo, Japan). qPCR assay was performed with QuantiTect SYBR Green PCR kit (QIAGEN) in Light Cycler 480 apparatus (Roche). Real-time PCR reaction was performed in an ABI 7500 Fast Real-Time PCR System (Applied Biosystems). Primers were as follows: RIG-I-F, 5′-GACGGTCAGCAGGGTGTACT-3′; RIG-I-R, 5′-CCCGTGTCCTAACGAACAGT-3′; MDA5-F, 5′-AGAGCCCGTCCAAAGTGAAGT-3′; MDA5-R, 5′-GTTCAGCATAGTCAAAGGCAGGTA-3′;34 (link) IGF-1R-F, 5′-TTAAAATGG CCAGAACCTGAG-3′; and IGF-1R-R, 5′-ATTATAACCAAGCCTCCCAC-3′.35 (link)
9
Quantifying mRNA Levels by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cellular total RNA isolated using Trizol (Life Technologies, Carlsbad, CA, USA) and PureLink™ RNA mini kit (Life Technologies), and converted into complementary DNA (cDNA) using the Primescript RT Mater Mix kit (Takara Bio, Otsu, Japan). cDNA were quantified by quantitative polymerase chain reaction (qPCR) on an LightCycler 480 apparatus (Roche Applied Science, Penxberg, Germany) using SYBR Premix Ex Tag™ kit (Takara Bio) and specific primers indicated in table S1 . Messenger RNA (mRNA) levels were subsequently normalized to those of β-actin.
10
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The cDNA was synthesized from RNA samples using a RevertAid First-Strand cDNA Synthesis kit (Takara, Dalian, China). qRT-PCR was performed with SYBR Premix ExTaq (Takara) with a LightCycler 480 apparatus (Roche Molecular Systems, Inc., Pleasanton, CA, USA). β-actin was used for internal control. The relative expression of genes was calculated by 2−ΔΔCq method. The sequences of primers were: ERK forward, 5′-GTGAAGTTCATTTCCAATCCGC-3′ and reverse, 5′-GGGACATCACCCTCACTTAC-3′; CREB forward, 5′-CCATCCACTCCTGTGTCATCT-3′ and reverse, 5′-CCTTGTAAATCCTCTTCCATCA-3′; BDNF forward, 5′-CACCCGCGAGTACAACCTTC-3′ and reverse, 5′-CCCATACCCACCATCACACC-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!