At least 24 DE-Gs genes that negatively correlated with promoter methylation were selected for qRT-PCR validation, and gene-specific primers (Table S1 ) were designed using Primer3 (Untergasser et al., 2012 (link)). RNA was extracted from leaves of hybrid and parental lines (same samples used in WGBS and RNAseq) using NucleoSpin RNA plant kit (Macherey-Nagel, Germany) following manufacturer’s protocol. The quality and integrity of extracted RNA was checked using NanoDrop 1000 (Thermo Scientific) and 1% Agarose gel, respectively. Equally, ∼1 μg of total RNA was used to synthesize cDNA using PrimeScript IV 1 st strand cDNA Synthesis Mix (Takara). The real-time PCR reaction was set up using TB Green Premix Ex Taq II Master Mix (Clontech, USA) and run on the Bio-Rad CFX96 Real-Time System (Bio-Rad, USA) using the thermal profile of initial denaturation at 95°C for 30 s, followed by amplification step with 40 cycles of 95°C for 5 s and 60°C for 30 s. Then final amplification was completed at 65°C for 5 s, as described earlier (Dubey et al., 2019 (link); Ahmad et al., 2021b ). Further, qRT-PCR expression was compared with in silico RNAseq expression data. EF1-alpha was used as internal control, and significant expression difference was analyzed using two-way ANOVA test.
Primescript 4 1st strand cdna synthesis mix
Manufactured by Takara Bio
Sourced in China, Japan
PrimeScript™ IV 1st strand cDNA Synthesis Mix is a reagent for reverse transcription of RNA to cDNA. It contains reverse transcriptase, RNase inhibitor, and other necessary components for the first-strand cDNA synthesis reaction.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (3 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Lightcycler 480 instrument, by Roche (2 mentions)
Taq pro universal sybr qpcr master mix, by Vazyme (2 mentions)
Iq5 real time pcr instrument, by Bio-Rad (2 mentions)
Sybr green pcr master mix kit, by Takara Bio (2 mentions)
Tb green premix ex taq 2, by Takara Bio (2 mentions)
Tb green fast qpcr mix, by Takara Bio (2 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Nucleospin rna plant kit, by Macherey-Nagel (1 mentions)
Tb green premix ex taq, by Takara Bio (1 mentions)
Sybr green master mix reagent, by Bio-Rad (1 mentions)
Trizol, by Takara Bio (1 mentions)
Viia 7 system, by Thermo Fisher Scientific (1 mentions)
Universal rna extraction kit, by Takara Bio (1 mentions)
Tb green premix ex taq 2 fast qpcr, by Takara Bio (1 mentions)
7900ht real time pcr system and software, by Thermo Fisher Scientific (1 mentions)
Nanodrop d2000, by Thermo Fisher Scientific (1 mentions)
32 protocols using primescript 4 1st strand cdna synthesis mix
1
Validation of Methylation-Responsive Genes
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of the cell lines and tissues was extracted using TRIzol reagent (Cat: 15,596,026, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. Next, 1 µg of total RNA was reverse-transcribed to first-strand complementary DNA (cDNA) using PrimeScript IV 1st strand cDNA Synthesis Mix (Cat: 6215A, Takara) following the manufacturer’s instructions. The cDNA products were diluted to 1/10 using ddH2O for real-time PCR.
Thereafter, TB Green Premix Ex Taq (Cat: RR420Q, Takara) was used in a 10 µL final volume containing 1 µL diluted cDNA. PCR involved the following steps: (1) initial denaturation at 96℃ for 5 min; (2) 40 cycles of denaturation at 96℃ for 15 s, annealing at 60℃ for 20 s, and extension at 72℃ for 20 s; and (3) melting curves in progressive heating from 65℃ to 95℃. The gene expression level of the targets was normalized to that of GAPDH. The primers involved in the real-time PCR are presented in Table2 .
Thereafter, TB Green Premix Ex Taq (Cat: RR420Q, Takara) was used in a 10 µL final volume containing 1 µL diluted cDNA. PCR involved the following steps: (1) initial denaturation at 96℃ for 5 min; (2) 40 cycles of denaturation at 96℃ for 15 s, annealing at 60℃ for 20 s, and extension at 72℃ for 20 s; and (3) melting curves in progressive heating from 65℃ to 95℃. The gene expression level of the targets was normalized to that of GAPDH. The primers involved in the real-time PCR are presented in Table
3
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cell lines using TRIzol reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions as we previously reported60 (link),61 (link). cDNA was synthesized with PrimeScript™ IV 1st strand cDNA Synthesis Mix (Takara, China). qPCR analysis was performed using the Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd.), and GAPDH was used as an internal control. Each assay was carried out in triplicates in a Light Cycler 480 Instrument (Roche). The primers for RT-qPCR are shown in Supplementary Table 9 .
4
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-PCR (qPCR) were used to detect the mRNA level and were performed as described previously 19 (link). Briefly, total RNAs from cells were extracted using the TRIzol reagent (Invitrogen) according to the manufacturer's instruction. For first cDNA synthesis, total RNAs were performed reverse transcription using PrimeScript™ IV 1st strand cDNA Synthesis Mix (6215A, TakaRa, Japan). SYBR Green Master Mix reagent (Bio-Rad) and other reactants were carried out at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 65 °C for 15 s in CFX96 Real-Time System (Bio-Rad). GAPDH was used as an endogenous reference gene to normalize target gene expression by the ΔΔCt method. QPCR primer sequences are listed below: GAPDH-F: 5'-TGGACTCCACGACGTACTCA-3', GAPDH-R: 5'-AATCCCATCACCATCTTCCA-3'; CDH1-F: 5′-GGATGTGCTGGATGTGAATG-3′, CDH1-R: 5′-CACATCAGACAGGATCAGCAGAA3′; CDH2-F: CTGACACTGGTGGCACTACTAA, CDH2-R: ATTCTGGTACACAATACAGAGGCA; MMP2-F: AGCTAATCAGCATTCTCACTCCTAC, MMP2-R: CACAGAAGGTTGTGAAAGGAGAAGA, MMP9-F: AGATTGGGAACCAGCTGTATTTGTT; MMP9-R: AAGAAGAAAAGCTTCTTGGAGAGCC; VEGFA-F: ATTGTGGAGGCAGAGAAAAGAGAAA, VEGFA-R: AACCGGTACAAATAAGAGAGCAAGA.
5
Gene expression analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol (TAKARA, Japan) and first‐strand complementary DNA synthesis was performed using PrimeScript™ IV 1st strand cDNA Synthesis Mix (TAKARA, Japan). Quantitative PCR was performed in triplicate using the SYBR‐Green PCR Master Mix kit (Takara, Japan) on an IQ5 real‐time PCR instrument (Bio‐Rad, USA). The primers used were as follows:
DPYSL2 forward:5′‐GTGACTACTCTCTGCATGTGGA‐3′,
reverse: 5′‐TTACCCCGTGATCCTTCACAA‐3′,
GAPDH forward: 5′‐GGAGCGAGATCCCTCCAAAAT ‐ 3′,
reverse 5′‐GGCTGTTGTCATACTTCTCATGG ‐ 3′.
DPYSL2 forward:5′‐GTGACTACTCTCTGCATGTGGA‐3′,
reverse: 5′‐TTACCCCGTGATCCTTCACAA‐3′,
GAPDH forward: 5′‐GGAGCGAGATCCCTCCAAAAT ‐ 3′,
reverse 5′‐GGCTGTTGTCATACTTCTCATGG ‐ 3′.
6
RT-qPCR Analysis of Pluripotency Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using a Universal RNA Extraction Kit (Takara, Beijing, China) according to the manufacturer’s instructions. The mRNA was reverse-transcribed using a PrimeScript IV 1st strand cDNA Synthesis Mix (Takara). Then, RT-qPCR of the cDNA was performed using a TB Green Premix Ex Taq™ II FAST qPCR (Takara) on a ViiA7 System (Thermo Fisher Scientific, Waltham, MA, USA). The primer sequences used in this study were designed at the NCBI website (https://www.ncbi.nlm.nih.gov/ , accessed on 10 April 2023) and were as follows: SOX2 (forward, 5′-AACTCCATGACCAGCTCGCAGA-3′ and reverse, 5′-GGACTTGACCACCGAACCCAT-3′), NANOG (forward, 5′-TGGCTCTGTTTTGCTATATCCC-3′ and reverse, 5′-CATTACGATGCAGCAAATACGAGA-3′), OCT4 (forward, 5′-TATGCAAAGCAGAAACCCTCGT-3′ and reverse, 5′-TTCTCCAGGTTGCCTCTCACTCG-3′) and GAPDH or actin (forward, 5′-GGAGCGAGATCCCTCCAAAAT-3′ and reverse, 5′-GGCTGTTGTCATACTTCTCATGG-3′).
7
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction from HCT116 and LOVO cells was performed with TRIzol reagent (Invitrogen, United States). The concentration and quality of the extracted RNA were determined by a NanoDrop spectrophotometer (Thermo Scientific, United States). 1 μg RNA from each sample was reversely transcribed to cDNA with a PrimeScript™ IV 1st strand cDNA Synthesis Mix (Takara, China) according to the manufacturer’s instructions. The primer pairs for quantitative RT-PCR assay were described in Supplementary Table S2 . Data were analyzed using the comparative threshold cycle (CT) method with β-actin serving as the internal control, and the fold change was calculated using the 2−ΔΔCT method with a 7900HT Real-Time PCR system and software (Applied Biosystems, United States).
8
Extracting RNA from Quail Embryo Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The skin tissue of quail embryos was crushed and ground, and the total RNA
was extracted by TRIzol reagent (Invitrogen, Thermo Fisher Scientific, USA)
according to the manufacturer's instructions. The RNA concentration was detected by
a NanoDrop D2000 (Thermo Fisher Scientific, USA), and the RNA quality was
detected by 1 % agarose gel electrophoresis. Total RNA was reverse-transcribed into first-strand cDNA using the “PrimeScript™ IV 1st strand cDNA
Synthesis Mix” reverse transcription kit (TaKaRa, Japan) and stored at 20 C.
was extracted by TRIzol reagent (Invitrogen, Thermo Fisher Scientific, USA)
according to the manufacturer's instructions. The RNA concentration was detected by
a NanoDrop D2000 (Thermo Fisher Scientific, USA), and the RNA quality was
detected by 1 % agarose gel electrophoresis. Total RNA was reverse-transcribed into first-strand cDNA using the “PrimeScript™ IV 1st strand cDNA
Synthesis Mix” reverse transcription kit (TaKaRa, Japan) and stored at 20 C.
9
RNA Extraction and qRT-PCR Analysis in Cell Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After extracting the RNA from adherent cells, exfoliated cells and culture medium were collected for RNA extraction by TRIZOL regent as we previously reported [15 (link)], and cDNAs were synthesized with PrimeScript™ IV 1st strand cDNA Synthesis Mix (Takara, Beijing, China) for mRNA and Mir-X™ miRNA First-Strand Synthesis (Takara Bio USA, Inc., San Jose, CA, USA) for miRNA. QRT-PCR analysis was measured using the Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China). Each assay was carried out in triplicate by the Light Cycler 480 Instrument (Roche, Basel, Switzerland). The primers for RT-qPCR are provided in the Appendix B (Table A4 ).
10
Validating Differentially Expressed Genes via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the expression pattern of screened DEGs, qPCR was performed. According to Porebski et al. [68 ], the total RNA of each sample was extracted using Hexadecyltrimethylammonium Bromide (CTAB) method. We used PrimeScript™ IV 1st strand cDNA Synthesis Mix (Takara, Dalian, China) to synthesize cDNA from RNA, and diluted 5 times in ddH2O as a template. Primers for 21 genes were designed with the online software Primer3 Plus (http://primer3.ut.ee/ ) (Table S6 ). The qPCR was performed in a two-step method on Thermal Cycler Dice™ Real Time System III (Code No. TP950) (Takara, Dalian, China). Each reaction solution consisted of 10.0 μl of SYBR Premix Ex Taq™ (Takara, Japan), 0.4 μl of each primer (10 μM), 2 μl of cDNA, and 7.2 μl of RNase-free water in a total volume of 20 μl. The qPCR cycle parameters were set at 95 °C for 2 min, 95 °C for 10 s, and annealing temperature at 60 °C for 40 s, which comprised a total of 40 cycles. We selected grape gene Actin1 (GenBank Accession number AY680701) as a reference for gene expression analysis. We calculate the relative expression of mRNA using 2-ΔΔCT equation [69 ].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!