The knockdown studies were performed using lentiviral-mediated RNA interference. The lentiviral vectors with the sequences for the shRNAs were purchased from the Erasmus Center for Biomics (https://www.erasmusmc.nl/cs-research/erasmusmcresearch/biomics?lang=en ). A scrambled shRNA (shscramble) was used as control, as previously described [30 (link)]. The shRNA sequence used to knockdown the expression levels of ANXA1 was the following:CCGGGCCTTGTATGAAGCAGGAGAACTCGAGTTCTCCTGCTTCATACAAGGCTTTTTG. For the lentivirus production, a four plasmid system was used for the transient transfection of 293 T cells as previously described [30 (link)], followed by concentration with Amicon Ultra Centrifugal Filters-100 K Units (Merck KGaA, MA, USA). The titers of the concentrated lentiviruses were determined after infection of AF-MSCs cells with serial dilutions of the viral stock. The lentiviral titers were estimated at 10 [5 (link)]–5 × 105 infectious units (IU)/ml. For transduction, 5 × 104 AF-MSCs per well were seeded into 12-well plates and lentivirus was added at a multiplicity of infection (MOI) of 5 (AF-MSC-shANXA1).As a control, AF-MSCs transduced with a lentivirus for shscramble was used at the same MOI (AF-MSC-shscramble). After seven days, selection with 0.5 μg/ml puromycin (Sigma-Aldrich Ltd.) was performed for five days.
Amicon ultra centrifugal filters 100 k units
Manufactured by Merck Group
Sourced in United States
The Amicon Ultra Centrifugal Filters-100 K Units are lab equipment designed for rapid concentration and desalting of macromolecular solutions. The filters feature a molecular weight cut-off of 100 kDa, allowing for the retention of proteins and other large molecules while permitting the passage of smaller molecules and salts.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using amicon ultra centrifugal filters 100 k units
1
Lentiviral-mediated knockdown of ANXA1 in AF-MSCs
2
Lentiviral-mediated Knockdown of EIF3D and RHEB
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The knockdown study was performed using lentiviral-mediated RNA interference. The lentiviral vectors with the sequences for the shRNAs were purchased from the Erasmus Center for Biomics. The shRNA sequences targeting EIF3D and RHEB were 5′-CCGGCCTCAGACATACTCCATAGATCTCGAGATCTATGGAGTATGTCTGAGGTTTTTG-3′, respectively. A scrambled shRNA (shscramble) was used as control, as previously described [119 (link)]. For the lentivirus production, a four plasmid system was used for the transient transfection of 293T cells as previously described [120 (link), 121 (link)], followed by concentration with Amicon Ultra Centrifugal Filters-100K Units (Merck Millipore). The titers of the concentrated lentiviruses were determined after infection of HT1080 cells with serial dilutions of the viral stock. The titers were estimated at 5×108 – 109 infection units (IU)/ml. The lentiviruses were then used for the transduction of the target cell line T24M. As control T24M cells transduced with a lentivirus for shscramble was used. The knockdown effect was evaluated at the RNA level by real-time PCR and at the protein level by Western blot analyses as described in the following sections.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!