Ebr2a

293T cells were transfected with pClec9A-EGFP using Fugene HD. 48 hours later cells were harvested by disrupting the monolayer via repeated pipetting. The cells (1x10⁶ cells in 100μL/sample) were stained with 10μg/mL uncleaved AD8 gp140 (or the molar equivalent of AD8-scFv or AD8-scFab) or 10μg/mL 10B4 anti-Clec9A antibody, followed 5μg/mL of the secondary antibodies, either PGT121-CF647 (PGT121 antibody labelled with CF647 using a Mix-n-Stain CF647 Antibody Labelling Kit (Sigma Aldrich)) for the Env-containing samples, or anti-rat CF647, for the 10B4 sample. Prior to analysis cells were incubated with the live/dead stain Fixable Viability Dye eFluor 506 (Thermo Fisher Scientific), then fixed using 1% paraformaldehyde in PBS. Analysis was performed on a BD LSR II flow cytometer (Becton, Dickinson and Company) with fluorescence compensated as appropriate. Plots were created using the FlowJo v9 software. Control samples included cells that had been incubated with secondary antibody only, as well as unstained cells.
The DC cell line Mutu DC 1940 [75 (link)] was stained with the Env constructs as described for the 293T cells. Binding of a biotinylated anti-Clec9A monoclonal antibody (clone 10B4) and an isotype control (rat IgG clone eBR2a (eBioscience)) were detected using Streptavidin PE. Propidium iodide was used to label dead cells.

Freshly isolated naive CD4⁺ T cells from wild-type mice were cultured under Th17- polarizing conditions, with or without ITA treatment. After 2 days, 4.5 × 10⁶ cells were harvested, and ChIP was performed using the ChIP system (Thermo Fisher Scientific) according to the manufacturer’s instructions. The soluble chromatin supernatant was immunoprecipitated with an anti-RORγt antibody (40 μg mL⁻¹, clone AFKJS-9, eBioscience, 14-6988-82) and IgG control (40 μg mL⁻¹, clone eBR2a, eBioscience, 14-4321-82). Immunoprecipitated DNA and input DNA were measured by qPCR using a SYBR green reagent. Data were expressed as the percent input for each ChIP fraction. The primers used for amplification of the promoter of Il17a containing the RORγt-binding site were 5′ CAGCTCCCAAGAAGTCATGC 3′ (forward) and 5′ GCAACATCTGTCTCGAAGGTAG 3′ (reverse)^{47 (link)}.

After oral administration of MT-1303 at 0.3 mg/kg once daily for 3 days, blood and mesenteric lymph nodes were collected from C57BL/6 mice under isoflurane anesthesia. Single-cell suspensions were prepared from the mesenteric lymph nodes. Expression of the S1P₁ receptor on lymphocytes was examined by incubating the cell suspensions with rat anti-mouse S1P₁ mAb or rat IgG2a isotype control (eBR2a; eBioscience) at 40 μg/mL in flow cytometry staining buffer solution (FCS buffer; eBioscience) containing 1 mM EDTA and 2% normal mouse serum on ice in the dark for 1 h. The cells were then washed with PBS and incubated with biotin-conjugated anti-rat IgG antibody (Jackson ImmunoResearch Laboratories) at 7 μg/mL for 20 min, followed by PE-conjugated streptavidin (eBioscience) at 1 μg/mL for 20 min. Cell suspensions were subsequently incubated with 2% normal rat serum in FCS buffer for 20 min, followed by FITC-conjugated anti-mouse CD4 mAb for 20 min. After washing, the cells were resuspended in FCS buffer for flow cytometric analyses (LSR, BD Biosciences). Collected peripheral blood (0.1 mL) was hemolyzed and fixed using the IMMUNOPREP^TM Reagent System (Beckman Coulter). The number of lymphocytes, T cells, and CD4⁺ T cells was measured using a Cytomics^TM FC500 flow cytometer (Beckman Coulter) with Flow-Count^TM (Beckman Coulter) as the internal standard.

Whole liver or NK1.1 cell-depleted liver cells (1 × 10⁵) from T1D C57BL/6 mice were cultured with 10 pancreatic islets from BALB/c mice in 12-well plates with RPMI 1640 (Gibco) containing 10% heat-inactivated fetal bovine serum (Gibco) at 37 °C in a humidified 5% CO₂ atmosphere for three days63 (link)64 (link). To some wells, anti-IL-22 (eBiosciences, clone: IL22JOP), anti-NKG2A (eBiosciences, clone: 20d5) antibody or isotype control antibody (eBiosciences, clone: eBR2a) (1.5 μg ml⁻¹) were added on day 0. After three days, culture supernatants and cell lysates were collected and stored at −80 °C for further analysis.

Four Pecentage DSS (35–50,000 kDa; MP Biomedical) was administered via the drinking water from day 1 until day 5. For infection, mice were intraperitoneally (i.p.) injected with 10⁸ MAP, MAA, or MHS in endotoxin free Dulbecco's phosphate-buffered saline (PAA) 2 days after DSS administration (n = 3–5 mice per group). Body weight was monitored 2–3 times weekly. For secondary challenge, mice were injected 5 weeks post infection (5wk p.i.). Mice were sacrificed on day 1 post-secondary challenge. The total weight of liver and spleen were measured and the organs were harvested for histology. The colon length was measured, a 1–2 cm section was then obtained for histology, and the rest was homogenized for plating after washing with PBS. To deplete CD4 and CD8 T cells, 150 μg/mL anti-CD4 antibody (Clone GK1.5), anti-CD8 (Clone 53–6.7), or Rat IgG2b isotype control (eBR2a, eBioscience) as control were administered i.p. 2 days before secondary challenge.

Spleens from DBA/1 and NMRI mice were excised and pushed through a 70 μm mesh to obtain a single cell solution. Splenocytes from DBA/1 mice were frozen in 10% DMSO/FCS until FACS analysis. Cells were pelleted, incubated with Fc-block (anti-CD16/CD32, BD Pharmingen) and stained with following antibodies conjugated to either, PE, APC, APC-H7: CD25 (PC61.5, eBioscience) CD19 (1D3, eBioscience) and CD4 (GK1.5, BD Pharmingen). Following surface stain cells were fixed and permeabilized for staining of Foxp3 (FJK-16a, eBioscience) or isotype control (eBR2a, eBioscience). Cells were collected using a FACSCantoII equipped with FACSDiva software. Analysis was performed using FlowJo software and fluorochrome minus one (FMO) controls were used for gating when necessary.