Hard shell pcr plate

Manufactured by Bio-Rad

Sourced in United States

Hard-Shell® PCR plates are a line of high-quality microplates designed for use in polymerase chain reaction (PCR) applications. These plates are made from a rigid polypropylene material, ensuring durability and consistent well-to-well performance. The plates are available in various well formats to accommodate different experimental needs.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

96-well hard-shell PCR plates (7 citations) Hard shell 384-well PCR Plates (5 citations) Hard-Shell® 384-Well PCR Plates White Well Clear shell (2 citations) Hard-shell 96-well skirted PCR plates (2 citations) Hard-shell white PCR plates (2 citations) BioRad hard-shell PCR Plates (2 citations) Hard-Shell High-Profile Semi-Skirted 96-Well PCR Plates (2 citations)

19 protocols using hard shell pcr plate

Quantification of Viral Particles by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Infectious virus stocks were titrated on NB-324k cells by plaque assay or by infected cell hybridization assay [27 (link)]. Virus titers are expressed as plaque forming units (PFU) or replication units (RU) per milliliter of virus suspension. Full viral particles were quantified either by dot blot hybridization assays [29 (link)] or by quantitative real-time PCR. Briefly, viral DNA was extracted from iodixanol-purified virus stocks or subcellular fractions using QIAamp MinElute virus spin kit (Qiagen, Hilden, Germany) as recommended by the manufacturer. The DNA was eluted in nuclease-free water (Life Technologies, Carlsbad, CA, USA) and stored at −20 °C until measurement. A linearized pH1 plasmid in serial dilutions in nuclease-free water was used to standardize the qPCR. Quantification of viral DNA was carried out by real-time qPCR in a volume of 20 µL using TaqMan^® Universal Master Mix (Life Technologies, Carlsbad, CA, USA) supplemented with 0.3 µM of NS-specific primers and a dual-labeled TaqMan^® probe (5′-6-FAM and 3′-MGB, Europhins MWG, Ebersberg, Germany). PCR cycles were performed in white 96-well plates (Hard-Shell^® PCR plates, Bio-Rad, Hercules, CA, USA) for 40 cycles using a qPCR thermocycler (CFX96 Touch™ Real-Time PCR, Bio-Rad). Virus titers are expressed as the number of viral genomes (Vg) per milliliter of virus suspension.

Hashemi H., Condurat A.L., Stroh-Dege A., Weiss N., Geiss C., Pilet J., Cornet Bartolomé C., Rommelaere J., Salomé N, & Dinsart C. (2018). Mutations in the Non-Structural Protein-Coding Sequence of Protoparvovirus H-1PV Enhance the Fitness of the Virus and Show Key Benefits Regarding the Transduction Efficiency of Derived Vectors. Viruses, 10(4), 150.

+ Open protocol

+ Expand

Thermal Shift Analysis of XOAT1 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Thermal shift analysis of the protein stability of XOAT1 and its variants was compared using SYPRO Orange Fluorescent Dye (Huynh & Partch, 2015 (link)). Protein thermal shift assays were carried out using a CFX96^™ Real-Time System (Bio-Rad, USA) to detect fluorescent dye-bound denatured proteins according to the protocol from the manufacturer (https://www.biorad.com/webroot/web/pdf/lsr/literature/Bulletin_7180.pdf). In brief, 45 μL of protein (2 μM) in 75 mM HEPES-sodium salt buffer (pH 6.8) was mixed with 5 μL of 100× SYPRO Orange Protein Gel Stain (diluted from 5000× stock supplied by Sigma-Aldrich, USA; λ_ex 470 nm/λ_em 570 nm) in 96-well Hard-Shell® PCR plates (Bio-Rad, USA) and sealed with PCR Sealers^™ Microseal® ‘B’ Film (Bio-Rad, USA). Controls contain an equal volume of 75 mM HEPES-sodium salt buffer (pH 6.8) in lieu of protein. The program included an initial temperature hold of 10 °C for 31 s, followed by a temperature ramp from 10 °C to 95 °C at 0.5 °C increments with a 30-s hold at each temperature. Fluorescence reads using the “FRET” channel to measure the SYPRO Orange fluorescence signal were taken at the end of each hold, and the obtained data were processed using CFX Maestro^™ Software for calculation of the melting temperature (T_m) of each XOAT1 variant.

Wang H.T., Bharadwaj V.S., Yang J.Y., Curry T.M., Moremen K.W., Bomble Y.J, & Urbanowicz B.R. (2021). Rational enzyme design for controlled functionalization of acetylated xylan for cell-free polymer biosynthesis. Carbohydrate polymers, 273, 118564.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Aging Genes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from day two adult animals that were transferred at the L4 stage onto NGM agar plates with 10 μg/ml FUDR seeded with E. coli OP50 and grown at 25°C. RNA extraction and cDNA preparation were performed as described (Amrit et al., 2019 (link)). Quantitative RT-PCRs were performed using the Biorad CFX Connect machine. PCR reactions were undertaken in 96-well optical reaction plates (Bio-Rad Hard Shell PCR Plates). A 20 µl PCR reaction was set up in each well using the SYBR PowerUp Green Master Mix (Applied Biosystems, USA) with 10 ng of the converted cDNA and 0.3 M primers. For each gene at least three independent biological samples were tested, each with three technical replicates. Primers used in this study include TTCCATTTCAAGCCTGCTC (ctl-1 Fwd), ATAGTCTGGATCCGAAGAGG (ctl-1 Rev), GGATTTGGACATGCTCCTC (rpl-32 Fwd) (Amrit et al., 2019 (link)), and GATTCCCTTGCGGCTCTT (rpl-32 Rev) (Amrit et al., 2019 (link)).

Schiffer J.A., Servello F.A., Heath W.R., Amrit F.R., Stumbur S.V., Eder M., Martin O.M., Johnsen S.B., Stanley J.A., Tam H., Brennan S.J., McGowan N.G., Vogelaar A.L., Xu Y., Serkin W.T., Ghazi A., Stroustrup N, & Apfeld J. (2020). Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies. eLife, 9, e56186.

+ Open protocol

+ Expand

RNA extraction and RT-qPCR analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from frozen leaves using the TRIZOL method^{55 (link)}. Subsequently, 1 µg of RNA was treated with DNase (Thermo Fisher Scientific, Langerwehe, Germany) and subjected to cDNA synthesis using RevertAid reverse transcriptase (Thermo Fisher Scientific, Langerwehe, Germany). mRNA transcript abundance was quantified using RT-qPCR on a C1000 TouchTM Thermal Cycler (CFX 284TM Real-Time System, Bio-Rad, Feldkirchen, Germany) in 384-well Hard-Shell® PCR plates (Bio-Rad, Feldkirchen, Germany). Gene-specific primers (Supplementary Table S2) and iTaq™ SYBR® Green Supermix (Bio-Rad, Feldkirchen, Germany) were used for amplification. Data were normalized to the mRNA transcript level of ACTIN2.

Sistenich A.J., Fürtauer L., Scheele F, & Conrath U. (2024). Marker and readout genes for defense priming in Pseudomonas cannabina pv. alisalensis interaction aid understanding systemic immunity in Arabidopsis. Scientific Reports, 14, 3489.

+ Open protocol

+ Expand

Quantifying Gene Expression with qPCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To quantify specific transcripts, commercially available Taqman real-time quantitative PCR (qPCR) assays (Thermo Fisher Scientific) were used to measure genes of interest and housekeeping genes (Supplementary Table S2). We also used proprietary Taqman qPCR assays targeting the WT^{29 (link)} and zQ175 knockin Htt alleles separately. For the knockin allele, the forward primer was GCCCGGCTGTGGCTGA, the reverse primer was TTCACACGGTCTTTCTTGGTGG and the ZEN probe was TGCACCGACCAAAGAAGGAACTCT (Integrated DNA Technologies). cDNA was diluted 1:50 nuclease-free water (Sigma) and plated in 96-well thin wall Hard-Shell PCR plates (BioRad). Each 15 μL reaction per sample contained 1 × Taqman Fast Advanced Mastermix (Thermo Fisher Scientific), 1 × Taqman Gene expression assays and 3 μL of diluted cDNA (1:50 in nuclease-free water) and was aliquoted into the 96-well plates and sealed. Plates were centrifuged at 8 × 10³ g for 30 s and then analysed using a BioRad CFX96 thermal cycler with the following program: 95 °C for 40 s, followed by 40 cycles of 95 °C for 7 s, 60 °C for 20 s. All biological replicates were run in triplicate. C_q values deviating by ± 0.25 from the mean of the triplicate were removed from the analysis. Data for genes of interest were normalised to reference genes (CanX, Ubc and Atp5b) as per the 2^-ΔΔCt2 method^{36 (link)}.

Mason M.A., Gomez-Paredes C., Sathasivam K., Neueder A., Papadopoulou A.S, & Bates G.P. (2020). Silencing Srsf6 does not modulate incomplete splicing of the huntingtin gene in Huntington’s disease models. Scientific Reports, 10, 14057.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of S18 or S26 cell was extracted using trizol reagent (Invitrogen) according to the manufacturer's instructions. cDNA was synthesized using High Capacity RNA-to-cDNA Kit (Applied Biosystems^TM) according to the manufacturer's instructions. Real-time PCR amplification was performed by SYBR® Green PCR Master Mix (Applied Biosystems^TM) on a Hard-Shell PCR Plates (Bio-Rad). Relative quantification of each target gene was normalized by using an endogenous control (GAPDH). qPCR and analyses were performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad).

Ji J., Yu Y., Li Z.L., Chen M.Y., Deng R., Huang X., Wang G.F., Zhang M.X., Yang Q., Ravichandran S., Feng G.K., Xu X.L., Yang C.L., Qiu M.Z., Jiao L., Yang D, & Zhu X.F. (2018). XIAP Limits Autophagic Degradation of Sox2 and Is A Therapeutic Target in Nasopharyngeal Carcinoma Stem Cells. Theranostics, 8(6), 1494-1510.

+ Open protocol

+ Expand

Real-Time qPCR Protocol for Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time qPCR was performed on a C1000 Thermal Cycler CFX96 Real-Time system (Biorad, Hercules, CA, USA), using Hard-Shell PCR Plates (96-well, thin-well, white) and Microseal ‘B’ seal (Biorad). Amplification was performed with 7 µL of SsoFast EvaGreen Supermix (Biorad) with 0.5 µM each of forward and reverse primer, 5 µL of cDNA as template, and RNase-free water up to 14 µL of total reaction volume, using the following conditions: 95 °C for 10 min, 40 cycles of 95 °C for 15 s, 60 °C for 1 min, according to the protocol published by Vandesompele and colleagues [45 (link)]. Each sample was run in triplicate, except for experiments assessing intra-assay variation, where 6 technical replicates were performed. In each experiment, a no-RT sample and a no-template sample were included as controls.
After each run, a melting curve analysis was performed, using the following conditions: 95 °C for 10 s, and 60 °C to 95 °C for 5 s. For all steps, a ramp rate of 0.5 °C/s was used. In selected experiments, agarose gel electrophoresis was performed to verify the unicity and size of each RT-qPCR amplicon. Details on the adherence to the MIQE guidelines are provided in the Supplementary Materials.

Nevone A., Lattarulo F., Russo M., Panno G., Milani P., Basset M., Avanzini M.A., Merlini G., Palladini G, & Nuvolone M. (2023). A Strategy for the Selection of RT-qPCR Reference Genes Based on Publicly Available Transcriptomic Datasets. Biomedicines, 11(4), 1079.

+ Open protocol

+ Expand

Quantifying Gene Expression in Arabidopsis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The transcript levels of FLC, FT and SOC1 were measured by reverse transcription qPCR. First, total RNA was extracted with TRIzol reagent from 10-day-old seedlings grown under long-day conditions at 23°C. Second, the cDNAs were synthesized by using the 5× All‐In‐One RT Master Mix (with an AccuRT Genomic DNA Removal Kit) (Abm, G492). Finally, quantitative PCR was carried out on Bio-Rad CFX96 Real-Time System using KAPA SYBR^® FAST qPCR Kit Master Mix (2×) Universal (Kapa Biosystems, KR0389). A 0.1 μg quantity of cDNA was used in 20 μl reaction volume for 39 cycles in Hard-Shell PCR Plates (Bio-Rad, hsp9601). Three technical replicates were analyzed for each reaction. ACT2 was also amplified as a reference gene, and primers for qRT-PCR are listed in Supplementary Dataset S5.

Qi P.L., Zhou H.R., Zhao Q.Q., Feng C., Ning Y.Q., Su Y.N., Cai X.W., Yuan D.Y., Zhang Z.C., Su X.M., Chen S.S., Li L., Chen S, & He X.J. (2022). Characterization of an autonomous pathway complex that promotes flowering in Arabidopsis. Nucleic Acids Research, 50(13), 7380-7395.

+ Open protocol

+ Expand

Tracking DNA-AuNP Dynamic Exchange

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA-AuNP dynamic exchange studies were completed as described previously^{47 (link)}. Briefly, the same DNA-AuNP conjugation protocol was employed using 15-nm-diameter AuNPs with fluorophore-labelled, thiolated DNA (A₁₀ single-stranded DNA oligomers labelled with Texas red at 5′ and thiol-modified at 3′, abbreviated TR-DNA). Fluorescent TR-DNA was tracked in various solution conditions and the displacement of DNA from the AuNP surface was monitored as an increase in TR fluorescence. For the apoplastic fluid condition, 40 μl of undiluted WT N. benthamiana apoplastic fluid was added to 10 μl of 25 nM TR-DNA-AuNP in 0.3× PBS solution (final concentration of 5 nM TR-DNA-AuNPs). For all other experimental conditions, 25 μl of twofold-concentrated solution was added to 25 μl of twofold-concentrated TR-DNA-AuNPs. All experiments were run in duplicate. Solutions were added by microchannel pipette into a 96-well PCR plate (hard shell PCR plates, Bio-Rad) and mixed by pipetting. The plate was sealed with an optically transparent adhesive seal (Microseal ‘B’ plate sealing film, Bio-Rad) and briefly spun down on a benchtop centrifuge. Fluorescence time series readings were measured with a Bio-Rad CFX96 real time qPCR system by scanning the Texas red channel every 30 s for 8 h at 22.5 °C (lid heating off).

Belting H.G., Shashikant C.S, & Ruddle F.H. (1998). Modification of expression and cis-regulation of Hoxc8 in the evolution of diverged axial morphology. Proceedings of the National Academy of Sciences of the United States of America, 95(5), 2355-2360.

+ Open protocol

+ Expand

Potato DNA Quantification via Asymmetric PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR was performed using 60 ng of potato DNA in 10 µl reaction volume [1× PCR buffer, 2.5 mM MgCl₂, 0.2 mM each dNTP, 0.02 µM forward primer, 0.2 µM reverse primer, 0.2 µM probe (Integrated DNA Technologies)] and 0.5 unit of Taq polymerase (Invitrogen). PCR was performed on a PTC-100 thermocycler (MJ Research Inc.) in 96-well plates. The program used was the following: 2 min at 94 °C, followed by 55 cycles of 40 s at 94 °C, 40 s at annealing temperature (Ta), and 45 s at 72 °C, then 5 min at 72 °C as a final extension step. Finally, the reaction was cooled to 25 °C. PCR products were evaluated on a 1% agarose gel electrophoresis. The asymmetric PCR was performed in Hard-Shell PCR plates, 96 wells, thin walled (Bio-Rad, cat. HSP9665) with the addition of 1× LC Green (BioFire Defense). The reaction mixture was overlaid with 15 µl of mineral oil and the plates were covered with adhesive film Microseal B (Bio-Rad, cat. MSB1001). An extra step of 30 s at 94 °C was added to the PCR program to allow the formation of the hybrid between the probe and the strand in excess.

Herrera M.D., Vidalon L.J., Montenegro J.D., Riccio C., Guzman F., Bartolini I, & Ghislain M. (2018). Molecular and genetic characterization of the Ryadg locus on chromosome XI from Andigena potatoes conferring extreme resistance to potato virus Y. TAG. Theoretical and Applied Genetics. Theoretische Und Angewandte Genetik, 131(9), 1925-1938.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!