Absolute blue qpcr sybr green rox mix

To measure the expression levels of the CypB, CypD, and CypG genes, a quantitative RT-PCR (qRT-PCR) approach was used. The primer pairs used for the amplifications are listed in Table 1. Amplifications were performed using Absolute Blue qPCR SYBR green Rox mix (Thermo Scientific) and 5 pmol of each primer. To ensure the validity of the data, the expression of each gene was tested in triplicate in each of three biologically independent experiments. The cycling conditions were as follows: 15 min of activation at 95°C and 40 cycles of 15 s at 95°C, 30 s at 58°C (actin), 54°C (CypB, CypD, and CypG), and 30 s at 72°C. The channel source was 470 nm, with a detector at 510 nm. A Rotor-Gene 6000 machine (Corbett Robotics Pty. Ltd., Brisbane, QLD, Australia) and the accompanying software were used for qPCR data normalization and quantification. Average expression of actin cDNA, which was not regulated after virus acquisition experiments, was used as a reference as stated above, and the quantification was done using the relative expression method. For each run, standards were loaded onto the same plate to obtain the appropriate standard curve.

Total RNA was extracted using the EZ-RNA kit (#20-400; Biological Industries). Using the M-MLV reverse transcriptase (#AM2044; Ambion, Austin, TX), first-strand cDNA was generated from RNA samples. cDNA targets were quantified by qRT-PCR on Rotor Gene 6000 (Corbett Life Science, Concorde, NSW, Australia). Absolute Blue qPCR SYBR Green ROX mix (#AB-4163/A; Thermo Fisher Scientific, Waltham, MA) was used to detect transcripts, according to manufacturer's instructions. Two pairs of specific primers were used (Supplementary Table 1), designed to span different exons. Data were normalized to the housekeeping gene GAPDH. Dissociation curves for each primer set indicated a single product, and “no-template” controls were negative after the 40 cycles used for analysis. Quantification was performed by standard curves, within the linear range of quantification.

All primers in this study (S1 Table) were designed using Primer 3 (http://frodo.wi.mit.edu/primer3/), and synthesized by Eurofins MWG Operon. SYBR Green based qRT-PCR was performed using ABsolute Blue qPCR SYBR Green ROX Mix (AB-4162, Thermo Scientific), using a Step One Plus Real-Time PCR System (Applied Biosystems). For qRT-PCR data analysis, the fold change in the target gene relative to the GAPDH (glyceraldehyde 3-phosphate dehydrogenase) endogenous control gene was determined by the 2^–Δ(ΔCt) method, as described previously [6 (link), 15 (link), 18 (link)–21 (link)].

The PFC and hippocampus were dissected from female WT (n = 11) and HIV-1 Tg (n = 11) rats, and RNA was extracted with the TRIzol method (Invitrogen) using the RNeasy Mini Kit (Qiagen). RNA was reverse-transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). cDNA was standardized using a Pico Green Assay (Invitrogen). TaqMan Gene Expression Mastermix and TaqMan Gene Expression Assays for Hprt1 (Rn01527840_m1) and Cfb (Rn01526084_g1) were used. qPCR was performed on the Applied Biosystems 7900HT Sequence Detection System. Fold change in gene expression was calculated according to the 2^−ΔΔCt method using the Hprt1 housekeeping gene. The targets were run in triplicate, and the cutoff for coefficient of variance (CV) was 4%. One WT animal was excluded from Cfb analysis because its CV value exceeded the 4% cutoff.
Gene expression of Lcn2 (female WT n = 7, Tg n = 10) was assessed using primers from Integrated DNA Technologies (San Diego, CA, USA). Forward: GATTCGTCAGCTTTGCCAAGT and reverse: CATTGGTCGGTGGGAACAG. Absolute Blue qPCR SYBR Green ROX Mix (Thermo Scientific, Wilmington, DE, USA) was used to perform qPCR. Hippocampal gene expression of Lcn2 was normalized to the geometric mean of Hprt and B2m, whereas PFC expression of Lcn2 was normalized to the geometric mean of B-actin, Hprt1, B2m, and Ldha.

RNA from tissues was isolated using TriReagent (Molecular Research Center, Cincinnati, OH) with agitation and tissue lysing using a TissueLyser (Qiagen). Total RNA was isolated using the illustra RNAspin Mini kit from GE Healthcare (Buckinghamshire, UK) and was reverse transcribed using the Maxima First Strand cDNA Synthesis kit from Fisher. The following intron-spanning primer sets were used for both real-time and conventional PCR: CSH (F: AAAAAGGGCCCACAAGAGAC, R: GGGGTCACAGGATGCTACTC, β-Actin (F: ATCTGGCACCACACCTTCTACA, R: ACAGCCTGGATAGCAACGTACA). Real-time PCR was performed on 30 ng of cDNA using Absolute Blue QPCR SYBR Green ROX mix from Thermo Scientific, on an Applied Biosystems StepOnePlus real-time PCR system. Cycle parameters for both real-time and conventional PCR were 95 C for 15 minutes for polymerase activation, followed by 95 C for 30 sec, 67 C for 15 sec and 72 C for 1 minute. After normalization for β-actin, changes in gene expression were calculated from cycle threshold measurements [21] (link). Conventional PCR was performed on 50 ng of cDNA using Immomix Red 2X solution (Invitrogen) and an Eppendorf Mastercycler. The PCR products were electrophoresed on 1% agarose gels and visualized using ethidium bromide.