One microgram of each enriched sample was barcoded using EXP-NBD114 in a 50 μL of reaction mixture at room temperature for 15 min. The components of the 50 μL reaction mixture were as follows: 1× Quick Ligation Reaction Buffer (NEB, M2200), 5 μL of Quick T4 DNA Ligase (NEB, M2200), 2.5 μL of barcode (ONT, EXP-NBD114) and 1.2 μg of enriched DNA. The sample was then cleaned up using 0.4× AMPure XP beads. A total of 2.5 μg of barcoded DNA was used for adapter ligation as follows: 5 μL of AMII (ONT, EXP-NBD114), 10 μL of Quick T4 DNA Ligase (NEB, M2200), and 1× LNB (ONT, SQK-LSK110) were added to barcoded DNA in a total volume of 100 μL, followed by a 10-min incubation at room temperature. The sample was cleaned using 0.4× AMPure XP beads and used for sequencing.
Quick t4 dna ligase
Manufactured by New England Biolabs
Sourced in United States
The Quick T4 DNA Ligase is a high-performance enzyme used for the rapid and efficient ligation of DNA fragments. It catalyzes the formation of a phosphodiester bond between the 5'-phosphate and 3'-hydroxyl termini of double-stranded DNA. The enzyme exhibits rapid ligation activity, allowing for quick and reliable DNA assembly.
Automatically generated - may contain errors
Lab products found in correlation
Ultra 2 end prep reaction buffer, by New England Biolabs (3 mentions)
Ultra 2 end prep enzyme mix, by New England Biolabs (3 mentions)
T4 pnk, by New England Biolabs (3 mentions)
Qiaprep kit, by Qiagen (2 mentions)
Qiaquick gel purification kit, by Qiagen (2 mentions)
Pfu dna polymerase, by Roche (2 mentions)
Taq polymerase, by New England Biolabs (2 mentions)
Blunt ta ligase master mix, by New England Biolabs (2 mentions)
Ampure xp, by Beckman Coulter (2 mentions)
Ampure xp bead, by Beckman Coulter (2 mentions)
Cas9 nuclease, by New England Biolabs (2 mentions)
Engen sgrna synthesis kit, by New England Biolabs (2 mentions)
M cvipi gpc methyltransferase, by New England Biolabs (2 mentions)
Sqk lsk109, by New England Biolabs (2 mentions)
Nebnext da tailing kit, by New England Biolabs (2 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (2 mentions)
Quick ligation reaction buffer, by New England Biolabs (1 mentions)
Dynabeads oligo dt 25, by Thermo Fisher Scientific (1 mentions)
31 protocols using quick t4 dna ligase
1
Barcoding and Adapter Ligation for Nanopore Sequencing
2
Construction of NS5A Mutant Replicons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
D320E and D320E/Y321N NS5A substitutions were introduced into wild-type Con1 GT1 replicon as we described previously [21 (link)]. Con1-NS5A-D320E, and Con1-NS5A-D320E/Y321N were generated using the following forward and reverse phosphorylated (p) primer sets, respectively: (p)GGGCACGCCCGGAATACAACCCTCCACTGT and (p)ATATGGGCATCGCTCGAGGGAATTTCCTGG, and (p)GAGAACAACCCTCCACT GTTAGAGTCCTGGAAGGA and (p)CGGGCGTGCCCATATGGGCAT CGCTCGAGGGAATT. PCR products were circularized with Quick T4 DNA ligase (NEB) for 5 min and transformed into NEB 10-beta competent cells. The NS5A gene was sequenced to confirm the introduced substitutions.
3
Genomic and Plasmid DNA Extraction and Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA from C. acetobutylicum was isolated as previously described [27 (link)]. Plasmid DNA was extracted from E. coli with the QIAprep kit (Qiagen, France). Pfu DNA Polymerase (Roche) was used to generate PCR products for cloning, and Taq Polymerase (New England BioLabs) was used for screening colonies by PCR with standard PCR protocols employed for all reactions. DNA restriction and cloning were performed according to standard procedures [28 ]. Restriction enzymes and Quick T4 DNA ligase were obtained from New England BioLabs (Beverly, MA) and were used according to the manufacturer’s instructions. DNA fragments were purified from agarose gels with the QIAquick gel purification kit (Qiagen, France).
4
RNA-Seq Library Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA-Seq libraries were prepared as described by Zhong et al.57 (link) with minor modifications. Briefly, 5 μg of total RNA was used for poly(A) RNA capture using Dynabeads Oligo (dT)25 (Invitrogen), fragmented at 94 °C for 5 minutes and eluted. The first-strand cDNA was synthesized using reverse transcriptase SuperScript III (Invitrogen) with random primers and dNTP, whereas the second-strand cDNA was generated using DNA polymerase I (Enzymatics) using dUTP. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics) and adapter ligation (Quick T4 DNA Ligase, NEB), the dUTP-containing second-strand was digested by uracil DNA glycosylase (Enzymatics). The resulting first-strand adaptor-ligated cDNA was used for PCR enrichment (NEBNext High-Fidelity PCR Master Mix, NEB) for 14 cycles. Indexed libraries were pooled and sequenced.
5
Point Mutations in pCEP-Pu-DS-epi1 Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Point mutations were introduced into the pCEP-Pu-DS-epi123–775 plasmid by PCR amplification using a Platinum SuperFi II polymerase (Thermo Fisher Scientific) and the primers in Table 2 .
PCR-amplified products were phosphorylated with T4 PNK (NEB), ligated using Quick T4 DNA ligase (NEB) and then used to transform DH5-alpha competent E. coli (Thermo Fisher Scientific). Plasmids were purified using PureLink fast low-endotoxin midi plasmid purification kit (Thermo Fisher Scientific) and finally sequenced (Eurofins Genomics).
PCR-amplified products were phosphorylated with T4 PNK (NEB), ligated using Quick T4 DNA ligase (NEB) and then used to transform DH5-alpha competent E. coli (Thermo Fisher Scientific). Plasmids were purified using PureLink fast low-endotoxin midi plasmid purification kit (Thermo Fisher Scientific) and finally sequenced (Eurofins Genomics).
6
MinION Sequencing Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The barcoded dsDNA was purified using AMPure beads (bead: DNA, 1:1 volumetric ratio), repaired by dA-tailing end prepped, purified (bead: DNA, 1.6:1), and adapter ligated by using 60 μl of 700 ng pooled (equal volume) barcoded sample, 10 μl of Adapter Mix (AMX 1D), 20 μl of NEBNext Quick Ligation Reaction Buffer (5X) and 10 μl of Quick T4 DNA Ligase (New England Biolabs, Ipswich, MA). The reaction mixture was mixed gently by flicking the tube, and incubated for 10 min at RT. After bead purifying the prepared DNA library was eluted in 15 μl of elution buffer.
A FLO-MIN106 R9.4 flow cell (27 (link)) was equilibrated to RT for 10 min and then primed with running buffer as per manufacturer's instructions. The DNA libraries were prepared by combining 12 μL of the library pool with 2.5 μL NFW, 35 μL RBF (Running Buffer Fuel), and 25.5 μL library loading beads. After the MinION Platform QC run, the DNA library was loaded into the MinION flow cell via the SpotON port. The standard 1D sequencing protocol was initiated using the MinKNOW software v.5.12.
A FLO-MIN106 R9.4 flow cell (27 (link)) was equilibrated to RT for 10 min and then primed with running buffer as per manufacturer's instructions. The DNA libraries were prepared by combining 12 μL of the library pool with 2.5 μL NFW, 35 μL RBF (Running Buffer Fuel), and 25.5 μL library loading beads. After the MinION Platform QC run, the DNA library was loaded into the MinION flow cell via the SpotON port. The standard 1D sequencing protocol was initiated using the MinKNOW software v.5.12.
7
Native Barcoding and Sequencing Library Prep
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Seven hundred nanograms of each re-ligated sample in 45 μl of nuclease-free water was end-repaired, dA-tailed (NEB, Cat. no. E7546), cleaned with 1.5× volume Ampure XP beads, and eluted in nuclease-free water. Different Native Barcodes (NB-x) for each sample was ligated with Blunt/TA Ligase Master Mix (NEB, Cat.no. M0367), cleaned with 2× volume Ampure XP beads and eluted in nuclease-free water. Equimolar amounts of each sample was pooled to have 700 ng of DNA in 50 μl water. Barcode adapters (BAM) were ligated with Quick T4 DNA Ligase (NEB, Cat. no. E6056), cleaned with 0.4× volume Ampure XP beads and eluted using 15 μl Elution Buffer (ELB) following the manufacturer’s protocol (ONT, 1D native barcoding genomic DNA).
8
Plasmid DNA Sequencing Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To sequence the pool, an aliquot of the purified tagged pool plasmid DNA (∼0.5 μg) was digested with NotI-HF (New England Biolabs, R3189), gel purified, self-circularized using Quick T4 DNA Ligase (New England Biolabs, M2200) and gel purified again to isolate the self-ligated products using E-gel EX 1% agarose gels (Thermo Fisher Scientific, G401001). Next, fragments for Illumina sequencing were generated by inverse PCR performed as an emulsion PCR (ePCR) using an ePCR kit (Chimerx, 3600) according to the manufacturer's protocol. Illumina sequencing adapters were ligated to PCR products by standard A-tailing and enrichment PCR. Prepared samples were sequenced using a MiSeq (Illumina Inc., San Diego, CA, USA) and MiSeq Reagent Kit 600 cycle v3 (Illumina, MS-102-3003). The FASTQ files for each pool were analyzed with custom Python scripts to check each read-pair's barcode identities, perfect sequence match to a composite part design and uniqueness of the barcodes to one design. Full details on sequencing preparation, MiSeq sequencing and data analysis are provided in Supplementary Data . Scripts are available open source (MIT license) on GitHub at https://github.com/VoigtLab/MIT-BroadFoundry/tree/master/dialout-designs/ .
9
Ligation of Sequencing Adapters for ONT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequencing adapters were ligated to DNA ends during a 10-min incubation at room temperature in an 80 μL reaction mixture containing dA-tailed DNA from target enrichment, 3.5 μL of AMX-F (ONT, SQK-LSK110), 10 μL of Quick T4 DNA Ligase (NEB, M2200) and 1× LNB (ONT, SQK-LSK110). The sample was then cleaned up using 0.4× AMPure XP beads with two washes with SFB (ONT, SQK-LSK110) before elution in 17 μL of EB (ONT, SQK-LSK110). The eluted DNA was ready for sequencing after mixing with 37.5 μL of SBII (ONT, SQK-LSK110) and 20.5 μL of LBII (ONT, SQK-LSK110).
10
Native Barcode Amplicon Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All steps were followed according to the Native barcoding amplicons ONT protocol (EXP-NBD104, EXP-NBD114, and SQK-LSK109, version: NBA_9093_v109_revH_12Nov2019). Briefly, amplicons were end-prepped with the Ultra II End-prep kit, incubated at 20 °C for 5 min and 65 °C for 5 min, and cleaned using a 1:1 ratio of AMPure XP beads. Barcodes were ligated using the Blunt/TA Ligase and incubated for 10 min at room temperature followed by an additional 1:1 ratio AMPure XP (Beckman Coulter, Indianapolis, USA) Bead clean-up. Equal volumes of barcoded samples were pooled and Adapter Mix II (Oxford Nanopore Technologies, New York, NY, USA) sequences were added via Quick T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) and incubated at room temperature for an additional 10 min. A final AMPure XP bead clean-up was performed prior to loading the completed libraries on to flow cells.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!