Uno 2

Reverse transcription was performed using Transcriptor High Fidelity cDNA Synthesis Kit with Oligo dT (Roche Holding AG, Basel, Switzerland) in thermal cycler (Biometra UNO II, Gottingen, Germany). All the primers were designed by Primer 3 software (Whitehead Institute for Biomedical Research, Cambridge, MA, USA) (Table 1). The primers were purchased from the Laboratory of DNA Sequencing and Oligonucleotide Synthesis, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland.

PCR was carried out in a Biometra UNOII thermocycler (Biometra, Germany) using a PCR Mix Plus Green (A&A Biotechnology, Poland), by following the instructions provided by the manufacturer. The reaction was carried out in 25 µl and the reaction mixture contained: 12.5 µl PCR Mix Plus Green, 200 nM of F and R primers (2 × 2 µl), 1 µl of template DNA and 7.5 µl of ddH₂O. The cycling conditions consisted of 4 min of initial denaturation at 95 °C, followed by 30 cycles: 30 s denaturation at 95 °C, 30 s annealing at 55 °C, and a 45 s extension period at 72 °C with a final 5 min extension at 72 °C. The non-recombinant plasmid pT7-MAT-2 was used as a negative control. The amplification products were visualized after electrophoresis on a 1.5% agarose gel and an ethidium bromide staining procedure.

Half a microgram of total RNA was taken for cDNA synthesis using Omniscript RT Kit (Qiagen), random primers (4 μM, Sigma-Aldrich), oligo(dT) primer (1 μM, QBiogene Inc.), and RNase inhibitor (10 U, Fermentas). The reaction was performed in 20 μl of total volume, according to manufacturer’s protocol, using thermocycler UNO II (Biometra). The cDNA was diluted 10-fold and a 5-μl aliquot was taken for real-time PCR performed using Taqman 2× PCR Master Mix (Roche), Exiqon probe (100 nM), and appropriate primers (200 nM each; Data Sheet 1 in Supplementary Material) designed using dedicated software from the Roche web site. The reaction was carried out using ABI PRISM7700 Sequence Detection System (Applied Biosystems) and the following thermal conditions: 2 min at 50°C, 10 min at 95°C, 40 cycles of 15 s at 95°C, 1 min at 60°C, and 1 min at 72°C. The experiments were performed in triplicates. The relative amount of cDNA was calculated using comparative ΔC_t method. ΔC_t values of the samples of interest were compared with a calibrator (RNA of known concentration pooled from several samples). The C_t values of both the calibrator and the samples of interest were normalized to the expression of three control genes, ATP6V1, HADHA, and UBE2D2.

The detailed procedures of the potato transformation, plant genomic DNA extraction, total RNA extraction, reverse transcription, PCR-Southern, Southern Blot and RT-PCR were conducted as described previously [49 (link)]. In brief, the slices of the ‘Shepody’ microtubers were used as the receptor for Agrobacterium-mediated transformation. The AtHKT1 gene was amplified using the forward primer 5′- CGGGATCCATGGACAGAGTGGTGGCAAAAATAG -3′(1 - 31 bp) and the reverse primer 5′- CGGAGCTCTTAGGAAGACGAGGGGTAAAGTATCC - 3′(1490 - 1521 bp), which generated an expected PCR product fragment of 1521 bp. The amplification was performed in a thermal cycle (UNO II, Biometra) programmed for one cycle of 1 min at 94 °C, followed by 35 cycles of 50 s at 94 °C, 60 s at 55 °C, and 90 s at 72 °C. A final extension step was performed for 10 min at 72 °C.

Stable generated cell lines were seeded on tissue culture dishes 100, (Cell + , 83.3902.300, Sarstedt, Nümbrecht, Germany) at 4 × 10⁵ cells/mL and harvested 48 h after induction with doxycycline by trypsinisation. Detached cells were centrifuged (10 min, 150 g, 4 °C), pelleted cells resuspended in 1 mL ice-cold PBS including a protease inhibitor cocktail (10 μg/mL aprotinin and pepstatin A, 16 μg/μL leupeptin, 1 mM PMSF) and aliquoted to 0.2 mL soft PCR tubes at 100 µL. Samples were heated for 3.5 min at ascending temperatures (RT, 37 °C,40 °C, 42 °C, 44 °C, 46 °C, 50 °C, 54 °C, 58 °C) using a thermal cycler (UNO II, Biometra, Göttingen, Germany) and then equilibrated to room temperature for 3 min. Cells were lysed by three consecutive freeze–thaw cycles between liquid nitrogen and a water bath at room temperature. HiBiT-tagged DYRK1 construct in the supernatant were measured using the HiBiT lytic assay.

Half a μg of total RNA was taken for cDNA synthesis using Omniscript RT Kit (Qiagen), random primers (4 μM, Sigma-Aldrich), oligo(dT) primer (1 μM, QBiogene Inc.), and RNase inhibitor (10 U, Fermentas). The reaction was performed in 20 µl of total volume, according to manufacturer’s protocol, using thermocycler UNO II (Biometra). The cDNA was diluted tenfold and a 5 μl aliquot was taken for real-time PCR performed using Taqman 2x PCR Master Mix (Roche), Exiqon probe (100 nM) and appropriate primers (200 nM each; Supplementary Table 1) designed using dedicated software from the Roche Web site. The reaction was carried out using ABI PRISM 7700 Sequence Detection System (Applied Biosystems) at the following conditions: 2 min at 50 °C, 10 min at 95 °C, 40 cycles of 15 s at 95 °C, 1 min at 60 °C, and 1 min at 72 °C. The experiments were performed in triplicates. The relative amount of cDNA copies was calculated using the modified Pfaffl model (Pfaffl 2001 (link)) ( $Q=E^{\mathrm{\Delta }{C}_t}$ , where E is reaction efficiency and ΔC_t = C_{t calibrator} – C_t sample). The calibrator sample was a mixture of several samples of total RNA of known concentration. The gene expression was normalized to the expression of three genes: ATP6V1, HADHA, and UBE2D2, selected by GeNorm program (ver. 3.5). After quality assessment, all data samples were used for final analysis.

Total RNA was isolated from Arabidopsis thaliana leaves with Trizol Reagent (Invitrogen, 15596026). Genomic DNA was digested by DNase I (TaKaRa, 2270 A). Five micrograms of total RNA were used for cDNA first-strand synthesis using the PrimeScript^TM 1st strand cDNA Synthesis Kit (TaKaRa, 6110A). All steps were according to the description of the manufacturer. The AtHKT1 gene primers (Supplementary Table. S1) were designed based upon a published sequence of Arabidopsis thaliana HKT1 gene (GenBank accession No. AF237672). The cycling conditions (Supplementary Table. S1) were set up using a thermal cycler (UNO II, Biometra). Then the PCR products were cloned into the easy cloning vector pMD 18-T and reproduced in Escherichia coli DH5α for preservation and sequencing.