IgG extraction from the same plasma samples used for CPAs separation was carried out using Protein G Spin Columns (Thermo Scientific, UK) following the manufacturer’s protocol. The fraction of purified antibodies was determined measuring the relative absorbance of each fraction at 280 nm and the buffer exchanged into PBS using Amicon Ultra centrifugal filter with 100 kDa molecular weight (MW) cut-off (Millipore Merck, UK).
Protein g spin columns
Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom
Protein G Spin Columns are affinity chromatography-based laboratory equipment used for the rapid and efficient purification of antibodies and other immunoglobulins from complex biological samples. The columns contain immobilized Protein G, a bacterial cell wall protein that binds to the Fc region of immunoglobulins, allowing for selective capture and isolation of the target proteins.
Automatically generated - may contain errors
4 protocols using protein g spin columns
1
Purifying IgG from Plasma Samples
2
Immunodetection of CIDRa2.1 Domain Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The recombinant CIDRa2.1 domain of PF3D7_0617400 (MAL6P1.252) was produced at the Statens Seruminstitut, Cophenhagen, Denmark as described in [18 (link)] and used to immunize mice. Blood of immunized mice was sent to the Institute of Tropical Medicine, Tübingen, Germany. Mouse sera containing IgG α PF3D7_0617400 mouse secondary antibody were depleted from RBCs by filtering through a MN 615 ¼ filter. IgG was purified using Protein G Spin Columns from Thermo Scientific according to the manufacturer’s protocol.
For IFA, very thin blood smears of parasite cultures were fixated in − 20 °C cold 100% methanol for 5 min and then stored at − 20 °C until further use. IFA was performed following a modified protocol as previously described [29 (link)].
After a 5 min rehydration step in 1xPBS, slides were incubated for 1–2 h with anti CIDRa2.1 PF3D7_0617400 (diluted 1:50 in 1xPBS/1%BSA). The slides where then washed 3× with 1xPBS and incubated for 1 h with Alexa488 coupled mouse sera IgG α PF3D7_0617400 mouse secondary antibody (not diluted, 0.44 mg/ml). After another 3× washing with 1xPBS, slides were stained with Hoechst 33342 (diluted 1:1000) for 30 min. Slides were mounted over night with MOWIOL-488 and viewed through 100× oil immersion lens at a fluorescent microscope.
For IFA, very thin blood smears of parasite cultures were fixated in − 20 °C cold 100% methanol for 5 min and then stored at − 20 °C until further use. IFA was performed following a modified protocol as previously described [29 (link)].
After a 5 min rehydration step in 1xPBS, slides were incubated for 1–2 h with anti CIDRa2.1 PF3D7_0617400 (diluted 1:50 in 1xPBS/1%BSA). The slides where then washed 3× with 1xPBS and incubated for 1 h with Alexa488 coupled mouse sera IgG α PF3D7_0617400 mouse secondary antibody (not diluted, 0.44 mg/ml). After another 3× washing with 1xPBS, slides were stained with Hoechst 33342 (diluted 1:1000) for 30 min. Slides were mounted over night with MOWIOL-488 and viewed through 100× oil immersion lens at a fluorescent microscope.
3
Serum Transfer for Neonatal Immunity
4
Generating UZGENT_A3 and UZGENT_G5 Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids encoding heavy chains of UZGENT_A3 and UZ_GENT_G5 were subjected to PCR reactions with primers containing mismatches resulting in AAC to CAG codon change.
| Primer name | Polarity | Primer sequence |
|---|---|---|
| UZGENT_A3 HC-N59Q | Sense | GATCAACCCTAACAGTGGCGGAACACAGTACACACAGAAGTTTAAG |
| UZGENT_A3 HC-N59Q | Antisense | CTTAAACTTCTGTGTGTACTGTGTTCCGCCACTGTTAGGGTTGATC |
| UZGENT_G5 HC-N59Q | Sense | CTATCAGTGGTGCCACACAGTATACACAGAAGTTTCAGGG |
| UZGENT_G5 HC-N59Q | Antisense | CCCTGAAACTTCTGTGTATACTGTGTGGCACCACTGATAG |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!