The GFP-BAX construct used for tissue culture cell experiments was previously described (121 (link)). The HDAC3-Flag construct was a gift from Eric Verdin (Addgene plasmid no. 13819: Addgene, Cambridge, MA). The mitoBFP construct was described previously (11 (link), 53 ). Transgenes in these plasmids were all driven by the CMV promoter. Plasmids used for generating AAV2 viral particles were derived from the parent plasmid AAV-Pgk-Cre (Addgene plasmid no. 24593), a gift from Dr. Patrick Aebischer. The coding sequence for Cre was removed by digestion with EcoRI and SalI and was replaced with a sequence bridge of single cutting restriction sites. This bridge vector was used to subclone GFP-BAX (121 (link)), mCherry-BAX (which was generated in the laboratory by subcloning BAX into pmCherry-C1, Clontech/Takara Bio, Kusatsu, Shiga, Japan), and cytochrome c-GFP (Addgene plasmid no. 41182), a gift from Douglas Green. All plasmids were validated by sequencing.
Aav pgk cre
Manufactured by Addgene
The AAV-Pgk-Cre is a viral vector that contains the Cre recombinase gene under the control of the phosphoglycerate kinase (Pgk) promoter. It is designed for the delivery and expression of the Cre recombinase protein in target cells.
Automatically generated - may contain errors
7 protocols using aav pgk cre
1
Molecular Constructs for Cell Studies
2
Generating Fluorescent Protein Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The GFP-BAX construct used for tissue culture cell experiments was previously described [75 (link)]. The HDAC3-Flag construct was a gift from Eric Verdin (Addgene plasmid no. 13819: Addgene, Cambridge, MA). The mitoBFP construct was described previously [11 (link), 53 ]. Transgenes in these plasmids were all driven by the CMV promoter. Plasmids used for generating AAV2 viral particles were derived from the parent plasmid AAV-Pgk-Cre (Addgene plasmid no. 24593), a gift from Dr. Patrick Aebischer. The coding sequence for Cre was removed by digestion with EcoRI and SalI and was replaced with a sequence bridge of single cutting restriction sites. This bridge vector was used to subclone GFP-BAX [75 (link)], mCherry-BAX (which was generated in the laboratory by subcloning BAX into pmCherry-C1, Clontech/Takara Bio, Kusatsu, Shiga, Japan), and cytochrome c-GFP (Addgene plasmid no. 41182), a gift from Douglas Green. All plasmids were validated by sequencing.
3
Generation of HDAC3-mCherry Fusion Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The GFP-Bax construct used in these experiments was described by Semaan et al.,38 (link) the HDAC3-Flag construct was a gift from Eric Verdin (Addgene plasmid no. 13819; Addgene, Cambridge, MA, USA), and Mito-BFP construct was described in Maes et al.39 (link) Generation of the HDAC3-mCherry fusion protein construct was done by first amplifying Hdac3 cDNA from the plasmid pHdac3-tGFP (Origene, Rockville, MD) using the following primers containing Age I sites: FWD-5’-AGGAGATCTACCGGTGCGATCGCCATG-3’ and REV-5ʹ-CATCTCGACCGGTCGCGTACGCGTAATC-3ʹ. The Age I-Hdac3-Age I fragment was then ligated into pmCherry-C1 (Clontech, Mountain View, CA, USA). This plasmid and the empty pmCherry-C1 parent plasmid were used for nucleofection experiments (see below). The HDAC3-mCherry sequence was then excised with Nhe I and Hind III and cloned into a bridge vector created from AAV-Pgk-Cre (a gift from Patrick Aebischer, Addgene plasmid no. 24593) where the Cre coding region was removed and replaced with a restriction enzyme multiple cloning site, to create the AAV2/2-Pgk-HDAC3-mCherry plasmid. This plasmid was digested with Sma I to confirm the presence of inverted terminal repeats, and then sent to VectorBuilder/Cyagen Biosciences Inc. to obtain AAV2/2 virus particles. The pGEM p21 plasmid was a gift from Frederic Mushinski (Addgene plasmid no. 8443).
4
Targeted Liver Delivery of miR-192-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To specifically deliver either miR-192-3p or its sponge into mice livers, AAV DJ carrying transgenes of either constructs was tail vein injected, and repeated injections were performed once every 3 weeks. Alternatively, shNR3C1 construct was subcloned into pSicoR-mCherry vector (Addgene, USA; #31845). Lentivirus carrying pSicoR-shNR3C1 was i.v. injected into 4-week-old mice with diabetes, followed by AAV-pgk-Cre (Addgene; #24593) 2 weeks later. These mice were then sacrificed after 2 months. Red fluorescent signal intensity was detected by the In-Vivo Xtreme Imaging System (Bruker, USA).
5
Generating Recombinant AAV Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5′ GGAATTCATAGGGCGGCCGGGAA 3′ and 5′ AGCGCTGGCCGGCCGTTTAAAC 3′ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB, R0652) and EcoRI (NEB, R0101) sites to substitute the Cre recombinase gene. The eGFP sequence of AAV-CMV-eGFP (Addgene plasmid # 67634) was amplified using the primers 5′ GGAATTCATGGTGAGCAAGGGCGAG 3′ and 5′ AGCGCTTTACTTGTACAGCTCGTCCATG 3′, which was cloned into the digested AAV-PGK-backbone. These virus vectors were turned into a recombinant adeno-associated viral vector with serotype 1 as described in the previously published protocol [63 (link)]. For the present study, the following vectors were produced: AAV1-PGK-chst3 1.44 × 1012 gc/ml; AAV1-PGK-GFP 1.42 × 1012 gc/ml; AAV1-SYN-GFP 8.99 × 1012 gc/ml
6
Generation of Recombinant AAV Vectors
7
Adeno-associated Virus Techniques for Targeted Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adeno-associated virus particles (AAVs) used, purchased from Addgene (Watertown, MA), were AAV.pgk.Cre, pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (36) , pAAV-hSyn-DIO-mCherry, pAAV-hSyn-DIO-hM3D(Gq) (37) , pENN.AAV.hSyn.Cre.WPRE.hGH, and pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!