Lentivirus packaging cells were transfected with PGLV3-h1-GFP-puro vector (GenePharma, Shanghai, China) or pGLV5-h1-GFP-puro vector (GenePharma, Shanghai, China) containing either the RNPC1a knockdown (shRNPC1a) or RNPC1a overexpression (RNPC1a), and a scrambled sequence (SCR) or a negative control sequence (NC), respectively, following the manufacturer’s instructions. Three shRNA plasmids (sh1, sh2, sh3) were constructed against different RNPC1a targets, including a scrambled sequence as a negative control (Additional file 1 : Table S1). All plasmids were verified by sequencing (GenePharma, Shanghai, China). Cells were plated in 6 wells dishes at 30% confluence and infected with the retroviruses. Meanwhile, polybrene (5 μg/ml) was added with the retroviruses to enhance the target cells infection efficiency. Stable pooled populations of breast cancer cells were generated by selection using puromycin (2 μg/ml) for 2 weeks. For knockdown, one construct (sh3), with ≥85% knockdown efficiency, was used for further studies (Additional file 1 : Figure S1).
Pglv3 h1 gfp puro vector
Manufactured by GenePharma
Sourced in China
The PGLV3-h1-GFP-puro vector is a plasmid designed for gene expression studies. It contains a human H1 promoter, a green fluorescent protein (GFP) reporter gene, and a puromycin resistance cassette. This vector allows for the stable expression and selection of transfected cells.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Pglv5 h1 gfp puro vector, by GenePharma (2 mentions)
Puromycin, by Merck Group (2 mentions)
Lv6 puro vector, by GenePharma (1 mentions)
Ab146428, by Abcam (1 mentions)
Pglvh1 gfp puro vector, by GenePharma (1 mentions)
Polybrene, by GenePharma (1 mentions)
P21 sirna, by GenePharma (1 mentions)
Lipofectamine 3000 transfection agent, by Thermo Fisher Scientific (1 mentions)
14 protocols using pglv3 h1 gfp puro vector
1
Lentiviral Transfection for Gene Knockdown and Overexpression
2
Construction of AGPAT9 and LASS2 Lentiviral Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The AGPAT9 lentivirus expression vector was constructed by amplifying the coding sequence of human AGPAT9 and cloning it into the LV5/GFP/Puro (Genepharma, Shanghai, China) or LV6/Puro vector (Genepharma, Shanghai, China). Oligonucleotides were synthesized to generate an annealing shRNA targeting the sequence of AGPAT9 from position 606–626 (5′-GGGAACTCTGATCCAGTATA T-3′), 709–729 (5′-GGAAAGTGGCCACAGATAATG-3′), 758–778 (5′-GGACCT GCCTAATTACCTTCA-3′) or from 1204–1224 (5′-GGAGGAGAGAAGATAGGT ATT-3′). The fragments were cloned separately into pGLV3/H1/GFP/Puro vector (Genepharma, Shanghai, China) using the restriction sites BamHI and EcoRI.
The LASS2 lentivirus expression and shRNA-expressing vector were detailed in our previous study [11 (link)]. The other plasmids or recombinant vectors used are shown inSupplementary Tables 1 and 2 .
The LASS2 lentivirus expression and shRNA-expressing vector were detailed in our previous study [11 (link)]. The other plasmids or recombinant vectors used are shown in
3
Knockdown and Overexpression of NONHSAT143692.2 in SRA01/04 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The NONHSAT143692.2 lentiviral shRNAs were synthesized and sub-cloned into the pGLV3/H1/GFP&Puro vector (GenePharma) to knockdown the expression of NONHSAT143692.2. NONHSAT143692.2-overexpressing lentiviral constructs were generated by subcloning sh-NONHSAT143692.2 into pGLV5/EF-1aF/GFP&Puro vector (GenePharma). Empty vectors were used as negative controls, respectively. All the constructed plasmids were confirmed by sequencing (Invitrogen; Thermo Fisher Scientific, Inc.). They were added to SRA01/04 cells at approximately 70% confluency. The lentivirus was diluted in a 1:5 mixture with the medium and the total volume was approximately 1 ml. Stable SRA01/04 cells were then selected by puromycin (2.5 µg/ml, Sigma-Aldrich; Merck KGaA) for a further 48 h.
Human miR-4728-5p mimics/control and miR-4728-5p inhibitor/control were purchased from GenePharma. The transfection of SRA01/04 cells was carried out using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The final miR-4728-5p mimics/control concentration was 50 nM, and the final miR-4728-5p inhibitor/control concentration was 100 nM for transfection.
Human miR-4728-5p mimics/control and miR-4728-5p inhibitor/control were purchased from GenePharma. The transfection of SRA01/04 cells was carried out using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The final miR-4728-5p mimics/control concentration was 50 nM, and the final miR-4728-5p inhibitor/control concentration was 100 nM for transfection.
4
Plasmid and RNA Interference Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid with high LPAR3 expression, high circLPAR3expression, and the siRNAs targeting circLPAR3 were designed and synthesized by RiboBio (Guangzhou, China). In addition, shRNA targeting circLPAR3 was designed based on the siRNA sequence, which was then cloned into the pGLV3/H1/GFP/Puro vector (GenePharma). MicroRNA‐198 mimic, miR‐198 inhibitor, and the corresponding control sequences were designed and synthesized by GenePharma. The si‐circLPAR3, miR‐198 mimic/negative control (NC), and miR‐198inhibitor/NC sequences used in experiment were shown in Table 2 .
5
Investigating EphB3 in Esophageal Squamous Cell Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEEC cells (BNCC337729) were supplied by the Beina Chuanglian Biotechnology Institute (Beijing, China). The ESCC cell line TE-1 (TCHu89) was sourced from the Cell Bank of the Chinese Academy of Sciences and TE10, TE-13, KYSE-150, KYSE-450 were gifts from Professor Sun of Nanjing Medical University. Dulbecco’s modified Eagle’s medium (containing 10% fetal bovine serum and 1% penicillin and streptomycin) was used to culture the cells in reagents and supplements supplied by GIBCO Invitrogen Inc. (Carlsbad, CA, USA). The ESCC cells were treated with 5 µg/mL AKT activator SC79 (ab 146428, Abcam) for 48 h. To generate cell lines that stably suppressing EphB3, EphB3-targeting shRNA or scrambled shRNA sequences were cloned into the linear lentiviral vector pgLV3/H1/GFP + Puro Vector provided by GenePharma (Shanghai); cells were then infected with the recombinant lentivirus. Next, they were selected after the addition of puromycin (2 µg/mL) to the culture medium for 14 days. shRNAs sequences were designed using software provided by Invitrogen and details are listed in Table S1 .
6
Lentiviral Knockdown and Overexpression of PKN2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human shRNA sequences specifically targeting PKN2 (PKN2 shRNA#1: 5′- CCGGTACTTTGGAAGTTCGTCTTATCTCGAGATAAGACGAACTTCCAGTATTTTTG-3′; PKN2 shRNA#2: 5′-CCGGGCAGGAATTAAATGCACATATCTCGA.
GATATGTGCATTTAATTCCTGCTTTTT -3′) were cloned into pGLVH1/ GFP + Puro vector (Genepharma). The expression construct of PKN2-WT (human) was generated by ligating full-length ORF of wild type PKN2 (1-936aa, Homo sapiens) and cloned into pGLV3/H1/GFP + Puro vector (Genepharma). PKN2-K686R mutant (human) was created with a dominant negative (DN)(K686R) point mutation at the ATP binding site. Lentivirus was produced and collected after plasmid transfection of 293 T cells. HT-29 and SW480 cells were transduced with PKN2 shRNA or scramble shRNA (shCTL) lentivirus expressing GFP. SW480 and HCT116 cells were infected with PKN2-WT (human), PKN2-K686R or control(Vector) lentivirus. Stable cell lines were selected by puromycin treatment (2 μg/ml) for 2 weeks. Knockdown or overexpression of PKN2 was confirmed by Western blotting.
GATATGTGCATTTAATTCCTGCTTTTT -3′) were cloned into pGLVH1/ GFP + Puro vector (Genepharma). The expression construct of PKN2-WT (human) was generated by ligating full-length ORF of wild type PKN2 (1-936aa, Homo sapiens) and cloned into pGLV3/H1/GFP + Puro vector (Genepharma). PKN2-K686R mutant (human) was created with a dominant negative (DN)(K686R) point mutation at the ATP binding site. Lentivirus was produced and collected after plasmid transfection of 293 T cells. HT-29 and SW480 cells were transduced with PKN2 shRNA or scramble shRNA (shCTL) lentivirus expressing GFP. SW480 and HCT116 cells were infected with PKN2-WT (human), PKN2-K686R or control(Vector) lentivirus. Stable cell lines were selected by puromycin treatment (2 μg/ml) for 2 weeks. Knockdown or overexpression of PKN2 was confirmed by Western blotting.
7
Lentiviral shRNA for PWRN2 knockdown in KGN cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus shRNA construction and cell transfection were conducted using previously described methods [30 (link), 31 (link)]. We selected three target sequences to construct lentiviral shRNAs (LV-PWRN2-homo-502, LV-PWRN2-homo-1574 and LV-PWRN2-homo-1261) and included a negative control (LV-NC) (Table 2 ). The target sequences were used to design two complementary oligonucleotides, which were synthesised and cloned into pGLV3/H1/GFP + Puro Vector (GenePharma, China). The positive purified lentiviral shRNA-expressing plasmids were transfected with packaging plasmids into 293 T cells for lentivirus generation (GenePharma, China). The vectors described above were used to infect KGN cells. Stable KGN cell lines were selected using 3 μg/mL bulk puromycin-resistance culture (puromycin, Sigma, St Louis, MO, USA) for 5 days. Afterwards, the cells were examined microscopically for lentiviral GFP expression. The expression levels of PWRN2 in KGN/shPWRN2 cells and the corresponding negative-control KGN cells were tested by qRT-PCR to validate the effects of RNA interference.
Target sequences of lentiviral shRNAs for interfering PWRN2
| LV-shPWRN2 | Site | Target sequences |
|---|---|---|
| PWRN2-homo-502 | 502–522 | 5’-GCCATTCGGTTACCATCTACT-3’ |
| PWRN2-homo-1574 | 1574–1594 | 5’-GCAAAGGAATTACCGTTTACA-3’ |
| PWRN2-homo-1261 | 1261–1281 | 5’-GGCAGAAAGCAATGAAGAAGA-3’ |
| NC | Nonsense | 5’-TTCTCCGAACGTGTCACGT-3’ |
8
Cx43 Knockdown and Overexpression in T47D Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral pGLV3/H1/GFP+Puro vector (GenePharma, China) containing shRNA against Cx43 and pCDH/CMV/MCS/EF1/coRFP+Puro vector (GenePharma, China) containing chimeric Cx43 was constructed as previously reported 18 (link). shRNA with no target gene (scramble) was considered as a control. Lentivirus stably transfected to T47D/TS and T47D/TR cells in the presence of 5µg/mL polybrene (GenePharma, China). After 2 weeks, single independent clones were randomly isolated and plated separately to analyze for Cx43 knockdown or overexpression by western blotting.
9
Lentiviral Knockdown of YAP1 in SW 1353 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus particles expressing shYAP1 were produced by GenePharma Co., Ltd. (Shanghai, China). Briefly, a series of YAP1 targeting sequences were selected and cloned into a lentivirus-based RNAi system (pGLV3/H1/GFP + Puro Vector, GenePharma). shRNA target sequences were listed in Table S1 . The lentiviral shRNA-expression plasmids (SC or shY#4) were transfected with the packaging plasmids into 293T cells for lentivirus generation. Supernatants containing lentivirus were then harvested and concentrated. SW 1353 cells were then infected by applying viral supernatant (multiplicity of infection, MOI = 20) in 10 mL of complete medium for 24 h, and the stable cell lines were selected using 2 μg/mL puromycin for 3 days for two passages. Puromycin (1 μg/mL) was used to maintain the cells.
10
Lentiviral-Mediated YAP Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus packaging cells were transfected with PGLV3-h1-GFP-puro vector (GenePharma, Shanghai, China) containing either the YAP knockdown (shYAP) or a negative control sequence (NC). h-PDLSCs were infected at approximately 70% confluence by the culture medium with 8 μg/ml polybrene. After 6h, the medium was changed to basal medium supplemented with 10% FBS and cells were cultured for further assays. The efficiency for knockdown YAP was determined by Western blot and Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) assays. YAP-shRNA Sequences are listed in table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!