Mtor 3 utr

mTOR 3′UTR and its relative control plasmid with firefly-luciferase reporter system were purchased from Origene Technologies (Rockville, MD, USA). mTOR 5′UTR (GGGGCCTGAAGCGGCGGTACCGGTGCTGGCGGCGGCAGCTGAGGCCTTGGCCGAAGCCGCGCGAACCTCAGGGCAAG) was cloned into the pLightSwitch_5UTR (SwitchGear Genomics, Carlsbad, CA, USA) with renilla luciferase reporter system. Beta actin 5′UTR was used as a control. HeLa cells were transfected with plasmid DNA using Effectene (Qiagen, Limburg, Netherlands) according to the manufacturer's instructions, following transient siRNA knockdown of LARP1. Renilla and firefly control vectors were co-transfected respectively with the firefly and renilla-UTR vectors in a ratio of 25:75 to take into account the efficiency of transfection and cell numbers. Luciferase activity of the construct carrying either the 5′ or 3′ UTR was normalized to the relative control construct. Luciferase activity was assessed with the Dual-Luciferase Reporter assay system (Promega, Madison, WI, USA). Luminescence was measured using the Lumistar OPTIMA plate reader (BMG Labtech, Aylesbury, UK).