Total genomic DNA of the combined pellets from the triplicate samples was extracted using the Fast-DNA Spin kit (MPbio) according to the instructions of the manufacturer. Bacterial 16S rRNA genes containing hypervariable regions were amplified using the universal primer set, Bac27F (5′-adaptor B-AC-GAG TTT GAT CMT GGC TCA G-3′)/Bac541R (5′-adaptor A-X-AC-WTT ACC GCG GCT GCT GG-3′), where X denotes unique 7∼11 barcode sequences inserted between the 454 Life Sciences adaptor A sequence and the common linker, AC (Table S1 ). All PCR amplifications were performed as described previously [37] (link), and the PCR products were purified using a PCR purification kit (Bioneer, Korea). The purified PCR products were quantified using a SynergyMx ELISA reader equipped with a Take3 multivolume plate (BioTek, USA), and a composite sample for pyrosequencing was prepared by pooling equal amounts of the purified PCR products.
Pcr purification kit
Manufactured by Bioneer
Sourced in United States
The PCR purification kit is a laboratory tool designed to isolate and purify DNA fragments amplified through the polymerase chain reaction (PCR) process. The kit provides a reliable and efficient method for removing unwanted components, such as primers, nucleotides, and enzymes, from the PCR reaction mixture, allowing for the recovery of high-quality, purified DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Dna analyzers sequencing, by Bioneer (3 mentions)
Fastdna spin kit, by MP Biomedicals (2 mentions)
Dna extraction kit, by Bioneer (2 mentions)
Pmirglo vector, by Promega (2 mentions)
Plasmid mini extraction kit, by Bioneer (2 mentions)
Taq buffer, by Solgent (2 mentions)
Dntp mix, by Solgent (2 mentions)
H taq, by Solgent (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Accuprep plasmid extraction kit, by Bioneer (2 mentions)
Kanamycin, by Merck Group (2 mentions)
Dna purification kit, by Avantor (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Take3 multi volume plate, by Agilent Technologies (1 mentions)
Thermal cycler, by Bio-Rad (1 mentions)
2216e medium, by Solarbio (1 mentions)
1 kb dna ladder, by Thermo Fisher Scientific (1 mentions)
Deoxynucleoside triphosphate, by Thermo Fisher Scientific (1 mentions)
Nitrocellulose membrane, by Merck Group (1 mentions)
Diaminobenzidine, by Merck Group (1 mentions)
32 protocols using pcr purification kit
1
16S rRNA Gene Amplification and Sequencing
2
Cloning and Expression of Lipase Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5'-GCGACAGGCCATATGAGTCAGATTCCGGCTGA-3' and 5'-GCGTCAGGACTCGAGGTGTTTGAGAT-GTTTGTCG-3' were used as a primers and a restriction enzyme recognition site for NdeI was added. The Plasmid pET21a (+)-ORF3-6H (Fig. 1) was amplified by polymerase chain reaction (PCR) under the following conditions, 20 µl of 5× PCR buffer solution, 10 µl of Nsolution, 2 µl of each primer (100 pmole), 1 µl of template DNA, 1 µl of pfu DNA polymerase and 64 µl of sterilized water for a final volume of 100 µl. The amplification performed in a thermal Cycler (Bio-Rad, USA) was as follows: 30 cycles of 95℃ for 30 sec, 58℃ for 30 sec and 72℃ for 40 sec. The amplified PCR products were analyzed by 1.5% (w/v) agarose gel electrophoresis and purified with a PCR purification kit (Bioneer Co., Korea). The fragments were sequenced and introduced into pET21a(+) digested with NdeI-XhoI, and the resulting plasmid was named pET21a(+)-Lip1420-6H. To increase the solubility of the target protein, the plasmid pET21a (+)-MBP (or GST)-lipase was generated by overlap extension PCR of MBP (or GST) gene and lipase gene [20] .
3
Molecular Identification of Fungal Isolate
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The specific primers (ITS-4 and ITS-5) were used to amplify the ribosomal DNA (rDNA) of F. brachygibbosum isolate FIR 16_ITS fungus. The forward and reverse primer pair used in this study are ITS4-F-5′TCCTCCGCTTATTGATATGC3′ (20 mers) and ITS5-R-5′GGAAGTAAAAGTCGTAACAAGG3′ (22 mers) [White et al. 1990 ]. The primers were synthesized at Bioneer Company and supplied as lyophilised product of desalted oligos. The reactions were performed in 25 µL tubes with Taq Promega (USA), and the thermal cycling conditions used are as follows: 94 °C initial denaturation cycle for 4 min followed by 35 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min, and then a final extension at 72 °C for 10 min. The PCR products were checked on 1.0% agarose gel. The PCR products were purified using a PCR purification kit (Bioneer Company, Korea). The purified PCR products were sent to Bioneer Company Corporation for sequencing. The sequence was converted into a consensus sequence by using BioEdit Program Clust-alW. The resulting consensus sequence for the F. brachygibbosum isolate FIR 16_ITS was blasted against the whole nucleotide sequences in GenBank via National Center for Biotechnology Information (NCBI).
4
Isolation and Characterization of Dextranase-Producing Strain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In the course of this experiment, samples played a significant role. Samples collected from Gaogong Island were diluted with appropriate concentration and then spread on 2216E medium (Solarbio, China) containing Dextran blue 2000, cultured at 30°C for 48–72 h. The main focus of this step was to select strains with large transparent zone for further purification and enzyme activity determination. Afterward, the best dextranase-producing strain G6-4B was characterized by researching the biochemical and morphological characters. Genomic DNA was extracted, and 16S rDNA was amplified by PCR using universal primers (27F 5′-AGAGTTTGATCCTGGCTCAG-3′/1492R 5′-GGTTACCTTGTTACGCTT-3′). The amplified product was purified by PCR purification kit (Bioneer, USA), and nucleotide sequencing was blasted in NCBI (https://www.ncbi.nlm.nih.gov/ ). MEGA 6.0 software was used to make multiple comparisons with other strains of similar genetic relationships, and neighbor-joining method was taken to build a phylogenetic tree.
5
PCR Purification and Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR purification kit (Bioneer Co., Korea) was used to purify PCR products and sequencing was performed by the Bioneer Company (Korea). The nucleotide sequences were analyzed with the Chromas 1.45 software and the BLAST program from the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST ).
6
DNA Extraction and PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All materials for this study were purchased from Merck Company. The DNA extraction kit, PCR purification kit, and Master Mix for PCR amplification were bought from Bioneer Company. The 1-Kb DNA Ladder, high pure agarose, and primers were prepared by Massruler™, Invitrogen, and Cinnagen respectively. BeckMan Spectrophotometer DU530 and GFL Shaker Incubator 3031, 3033 were also used.
7
DNA Barcoding of Wild Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA barcoding of wild plant species.
DNA barcoding was performed to determine the identity (i.e., species) of the wild plants that were used for sap inoculations. The gene encoding maturase K (matK) of the chloroplast was amplified with primer pair matk-F (5′-CGTACAGTACTTTTGTGTTTACGAG-3′)/matk-R (5′-ACCCAGTCCATCTGGAAATCTTGGTTC-3′) or matk2.1af (5′-ACTCATCTGGAAATCTTAGT-3′)/matk5r (5′-GTTCTAGCACAAGAAAGTCG-3′). The matK gene is one of the most variable genes in angiosperms and is a promising candidate for barcoding because of its high evolutionary rate, which is important for distinguishing plant species (Kar et al. 2015) (link). AccuPower PCR PreMix was used for PCR amplification using 50 ng of DNA template. The PCR conditions consisted of an initial denaturation (94°C for 3 min) followed by 35 cycles at 94°C for 30 s (denaturation), 47°C for 30 s (annealing), and 72°C for 45 min (extension), and a final cycle (final extension) at 72°C for 10 min. The PCR products were run in a 1% agarose gel containing ethidium bromide, and the amplicons were visualized with a Benchtop UV transilluminator. The samples were purified with a PCR purification kit (Bioneer), and both strands were Sanger-sequenced by Bioneer (South Korea) or by the sequencing facility at Mbeya Zonal Referral Hospital Laboratory (Tanzania).
DNA barcoding was performed to determine the identity (i.e., species) of the wild plants that were used for sap inoculations. The gene encoding maturase K (matK) of the chloroplast was amplified with primer pair matk-F (5′-CGTACAGTACTTTTGTGTTTACGAG-3′)/matk-R (5′-ACCCAGTCCATCTGGAAATCTTGGTTC-3′) or matk2.1af (5′-ACTCATCTGGAAATCTTAGT-3′)/matk5r (5′-GTTCTAGCACAAGAAAGTCG-3′). The matK gene is one of the most variable genes in angiosperms and is a promising candidate for barcoding because of its high evolutionary rate, which is important for distinguishing plant species (Kar et al. 2015) (link). AccuPower PCR PreMix was used for PCR amplification using 50 ng of DNA template. The PCR conditions consisted of an initial denaturation (94°C for 3 min) followed by 35 cycles at 94°C for 30 s (denaturation), 47°C for 30 s (annealing), and 72°C for 45 min (extension), and a final cycle (final extension) at 72°C for 10 min. The PCR products were run in a 1% agarose gel containing ethidium bromide, and the amplicons were visualized with a Benchtop UV transilluminator. The samples were purified with a PCR purification kit (Bioneer), and both strands were Sanger-sequenced by Bioneer (South Korea) or by the sequencing facility at Mbeya Zonal Referral Hospital Laboratory (Tanzania).
8
DNA Extraction and Purification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Restriction endonuclease enzymes and silica-based DNA gel extraction kits were purchased from Fermentas (Thermo Fisher Scientific, Inc., Waltham, MA). PCR purification kit and DNA extraction kit were purchased from Bioneer (Bioneer, Korea). Deoxynucleoside triphosphate was purchased from Fermentas (Fermentas, Germany). The 10 × thermophilic buffer, pfu DNA polymerase, and MgSO4 got from Promega (Promega, Germany). Diaminobenzidine and nitrocellulose membrane were purchased from Sigma (Sigma, Germany) and Schleicher (USA). Oligonucleotides were used as primers for PCRs synthesis by Bioneer and ShineGene Molecular Biotech, Inc. (China).
9
Molecular Analysis of AdeABC Efflux Pump in A. baumannii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was performed on the A. baumannii isolates for the AdeABC genes. The primers utilized are presented in Table 1 . Briefly, the 25 µL PCR mixture contained 2.5 µL of bacterial DNA, 10 pM of each primer, 1.5 mM of MgCl2, 250 µM of each dNTP, 10 Mm of Tris-HCL (pH: 9.0), 30 Mm of KCL, and 1 U of Taq DNA polymerase (Bioneer Company, Korea, Cat. No. K-2012). Reactions were performed on a thermal cycler (Eppendorf, Master Cycler Gradient). Amplification was carried out with the following thermal cycling conditions: 5 min at 94°C and 30 cycles of amplification consisting of 1 min at 94°C, 1 minute at 45°C - 56°C, and 1 minute at 72°C, with 5 minutes at 72°C for the final extension. The PCR product bands were analyzed after electrophoresis on agarose gel (1%) at 90 V for 50 minutes in 1X boric acid (TBE), containing ethidium bromide, and the result was checked under UV irradiation. A PCR purification kit (Bioneer Co., Korea) was used to purify the PCR products, and sequencing was performed by the Bioneer Company (Korea). The nucleotide sequences were analyzed with the Chromas 1.45 software and BLAST in NCBI.
10
Molecular Cloning of LTB Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence of the ltb gene was adopted from GenBank with the accession number of M17874. The primer pair was designed by using the Oligo software. The sequences of forward and reverse primers were TGCAGAATTCGCTCCTCAGTC & TTACAAGCTTCTAGTTT-CCATACTGATTG, respectively. The ETEC strain was cultured in LB broth, and bacterial genome was extracted via the CTAB-NaCl method. The PCR was carried out in a reaction composed of 50 ng/ml of DNA, 4 pM of forward and reverse primers, 0.4 mM of dNTP mix, 3 mM of MgCl2, 1X PCR buffer and 4U Taq DNA polymerase (Cinnagen Tehran, Iran) in a volume of 25 μl. Thermocycler stages set for 94 °C for 5 min as initial denaturing and 30 cycles of 94 °C (30 sec), 58 °C (30 sec) and 72 °C (60 sec) respectively for denaturing, annealing and a final 5 min at 72 °C. PCR purification kit (Bioneer Daejeon, Korea) was applied to purify PCR products. pET28a vector and PCR products were digested with EcoRI and HindIII restriction enzymes and purified before proceeding with the ligation reaction. Ligation was performed with T4 DNA ligase overnight at 14 °C, and the mixture was transferred into fresh prepared competent E. coli BL21 (DE3) cells. Transformed clones were confirmed by colony PCR and restriction digestion analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!