Anti flag m2 conjugated agarose beads

Manufactured by Merck Group

Anti-FLAG M2-conjugated agarose beads are a laboratory product used for the purification and detection of proteins tagged with the FLAG epitope. The beads consist of agarose particles with the anti-FLAG M2 monoclonal antibody covalently attached, enabling the capture and isolation of FLAG-tagged proteins from complex samples.

Automatically generated - may contain errors

Lab products found in correlation

Protein a g beads, by Merck Group (4 mentions) Anti hdac1, by Cell Signaling Technology (1 mentions) Anti h3k4me2, by Cell Signaling Technology (1 mentions) Aminolink resin, by Thermo Fisher Scientific (1 mentions) Anti flag m2 magnetic bead, by Merck Group (1 mentions) Anti brd4 a301 985a, by Fortis Life Sciences (1 mentions) Protease inhibitor, by Roche (1 mentions) Q exactive mass spectrometer, by Thermo Fisher Scientific (1 mentions) Phenyl methyl sulfonyl fluoride (pmsf), by Merck Group (1 mentions) Mouse anti flag, by Merck Group (1 mentions) Ip lysis buffer, by Beyotime (1 mentions) Voyager de str instrument, by Thermo Fisher Scientific (1 mentions) Ab8898, by Abcam (1 mentions) Ab9053, by Abcam (1 mentions) Ab1791, by Abcam (1 mentions)

22 protocols using anti flag m2 conjugated agarose beads

Flag-GLI1 Immunoprecipitation and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids expressing Flag-GLI1 (424-1106), MEKK1 or empty vector were transfected in to the 293T cells using Lipofectamine 2000. After 24 h, the cells were washed with PBS and lysed in 1% NP-40, 50 mM HEPES pH 7.5, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 10 mM NaF, 1 mM Na₃VO₄, 1 mM DTT and protease inhibitors. Lysates were centrifuged and the supernatants incubated with anti-Flag M2 agarose conjugated beads (A2220; Sigma-Aldrich) overnight at 4°C. At the end of incubation, the agarose beads were washed extensively with lysis buffer and then with PBS. The immunocomplexes were eluted with 0.1 mg/ml Flag peptide, precipitated with 5% TCA and the pellet washed twice with acetone and analyzed as previously described (9 (link),24 (link)).

Antonucci L., Di Magno L., D’Amico D., Manni S., Serrao S.M., Di Pastena F., Bordone R., Yurtsever Z.N., Caimano M., Petroni M., Giorgi A., Schininà M.E., Yates JR I.I.I., Di Marcotullio L., De Smaele E., Checquolo S., Capalbo C., Agostinelli E., Maroder M., Coni S, & Canettieri G. (2018). Mitogen-activated kinase kinase kinase 1 inhibits hedgehog signaling and medulloblastoma growth through GLI1 phosphorylation. International Journal of Oncology, 54(2), 505-514.

+ Open protocol

+ Expand

Immunoprecipitation Protocol for FLAG/HA Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were treated with either DMSO (vehicle-control) or Tomivosertib at the indicated doses and time points. Samples were processed and immunoprecipitation was performed using anti-FLAG-M2 agarose conjugated beads (Sigma-Aldrich) or anti-HA Sepharose conjugated beads (Cell Signaling) as previously described [77 (link)].

Suarez M., Blyth G.T., Mina A.A., Kosciuczuk E.M., Dolniak B., Dinner S., Altman J.K., Eklund E.A., Saleiro D., Beauchamp E.M, & Platanias L.C. (2021). Inhibitory effects of Tomivosertib in acute myeloid leukemia. Oncotarget, 12(10), 955-966.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation of PITX2c

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 cells were transiently transfected with pEGFP-NFLAG-PITX2c or pEGFP-NFLAG-PITX2c-ΔHD. After 48 hours of initial transfection, cells were cross-linked by 1% formaldehyde for 15 minutes. Cell genomic DNA was then sheared into fragments by sonication. Cell lysates were pre-cleared by protein A beads (Pierce, IL) for 2 h at 4°C. Anti-FLAG M2 conjugated agarose beads (Sigma), anti-PTIP (Bethyl laboratory), anti-H3K4me2 (Cell Signaling Technology), anti-HDAC1 (Cell Signaling Technology) or IgG antibody was then incubated with pre-cleared cell lysates at 4°C overnight. Beads were washed by the high salt and LiCl washing solution for eight times. Samples were reverse cross-linked in the high salt solution at 65°C overnight. DNA was purified by phenol-chloroform extraction and precipitated by isopropanol. PCR was then used to analyze precipitated DNA samples. The PCR primers (ATGGAAACGCTCCCGCTAGGT and AGGACCAAGTGTCGAGGGATT) covered the promoter (−133 to −7) of the human Cyclin A1. PCR parameters are: 94°C for 2 min; 94°C for 20 sec, 58°C for 20 sec, 72°C for 50 sec, 36 cycles; 72°C for 6 min.

Liu Y., Huang Y., Fan J, & Zhu G.Z. (2014). PITX2 associates with PTIP-containing histone H3 lysine 4 methyltransferase complex. Biochemical and biophysical research communications, 444(4), 634-637.

+ Open protocol

+ Expand

Transient Transfection and Immunoprecipitation

Check if the same lab product or an alternative is used in the 5 most similar protocols

S2 cell extracts were generated from three six-well plates transiently transfected with the appropriate set of expression plasmids using the DDAB method [44 (link)]. The cleared extracts (6 mg) were mixed with 40 μl of anti-FLAG M2–conjugated agarose beads (Sigma) for precipitating Flag-tagged proteins incubated for overnight at 4°C. In case of HA or Myc tagged proteins, the extracts were mixed with 10 μl of anti-HA antibody (mouse) or 10 μl of anti-Myc antibody (mouse) for 16 h at 4°C followed by incubation with the 20 μl anti-IgA/G–conjugated agarose beads (Sigma) at 4°C overnight. For knockdown with siRNA, siRNAs were added in a concentration of 100 pmol siRNA/well and 1 μg expression plasmids/well of a six-well plate. Protocols after immunoprecipitation were described [45 (link)]. Different cycles (25–30) were then performed, and the resulting products were run on 1% agarose gels and visualized using EtBr. Primer sequence used for RT-PCR as follows: mad (forward, GACCTCGACGCCCTG; reverse, CACTTGAAATAGACTTGA), hb (forward, GTTCCCCATCACCATCAC; reverse, TGAAAGGTGGCTACAGTT), sop (forward, ACTCCTTACCAGGC;reverse, ACATTTAAAAGTTTATGAC).

Malik S., Jang W., Park S.Y., Kim J.Y., Kwon K.S, & Kim C. (2019). The target specificity of the RNA binding protein Pumilio is determined by distinct co-factors. Bioscience Reports, 39(6), BSR20190099.

+ Open protocol

+ Expand

Affinity Purification of Flag-Tagged Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed as described^{29 (link),72 (link)}. Anti-Flag M2-conjugated agarose beads (Sigma) were incubated with the lysates overnight at 4 °C. The beads were then extensively washed and the bound proteins analyzed by western blotting.

Ren W., Fan H., Grimm S.A., Kim J.J., Li L., Guo Y., Petell C.J., Tan X.F., Zhang Z.M., Coan J.P., Yin J., Kim D.I., Gao L., Cai L., Khudaverdyan N., Çetin B., Patel D.J., Wang Y., Cui Q., Strahl B.D., Gozani O., Miller K.M., O’Leary S.E., Wade P.A., Wang G.G, & Song J. (2021). DNMT1 reads heterochromatic H4K20me3 to reinforce LINE-1 DNA methylation. Nature Communications, 12, 2490.

+ Open protocol

+ Expand

Affinity-Based Interactomics: Mapping Oncogenic Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

We provide a brief summary of publicly available datasets being re-analysed, for improved context of our analysis and results. Briefly, HRAS IP-MS samples were immunoprecipitated (Anti-Flag M2 Magnetic Beads, Sigma) from point mutant baits (via site-directed mutagenesis) and WT baits after using creation of stable cell lines (CAL-33, HET-1A and SCC-25) via lentivirus incorporation^{17 (link)}. For KRAS IP-MS cells were transfected with pCEFL-FLAG-KRAS^WT, or with pCEFL-FLAG-KRAS^G12C. Cell lysates (with the addition of protease and phosphatase inhibitors) underwent immunoprecipitation (anti-FLAG M2 conjugated agarose beads, Sigma-Aldrich; A2220). For elution and digestion 2 M Urea was used as well as 50 mM Tris-HCl (pH7.5), trypsin and DTT (for digestion).Finally, the BRD4 IP-MS was performed on nuclear extracts using an Anti‐BRD4 (A301‐985 A, Bethyl Labs) antibody (50 µg) was coupled to 100 µl AminoLink resin (Thermo Fisher Scientific).

Kourtis S., Cianferoni D., Serrano L, & Sdelci S. (2024). Detection of differential bait proteoforms through immunoprecipitation-mass spectrometry data analysis. Scientific Data, 11, 551.

+ Open protocol

+ Expand

Mapping Ubiquitination Sites in CtIP

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ubiquitination sites were mapped via mass spectrometry. Flag-CtIP, His-PPIL2, and HA-Ub were coexpressed in 293T cells for 4 h, then MG132 was added for 3 h before harvesting the cells and lysed them in NETN buffer [20 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 0.5% NP-40] containing a protease inhibitor cocktail (PIC, Roche). The cell lysate was centrifuged, and the supernatant was added to anti-Flag M2-conjugated agarose beads (Sigma). After incubating overnight at 4°C, the beads were centrifuged and washed thoroughly in NETN buffer. Subsequently, Flag-CtIP was eluted with NETN buffer containing FLAG peptide and analysed by Liquid Chromatography-Mass Spectrometry.

Qiu Z., Hao S., Song S., Zhang R., Yan T., Lu Z., Wang H., Jia Z, & Zheng J. (2022). PLK1-mediated phosphorylation of PPIL2 regulates HR via CtIP. Frontiers in Cell and Developmental Biology, 10, 902403.

+ Open protocol

+ Expand

Purification and Identification of SAMD1 Complex

Check if the same lab product or an alternative is used in the 5 most similar protocols

Flag-HA–tagged human SAMD1 was expressed after retroviral infection of HeLa-S. Nuclear extract was prepared from the established stable cell lines, and the SAMD1 complex was purified using anti-Flag (M2)–conjugated agarose beads (Sigma-Aldrich, A2220) by incubation in Tandem Affinity Purification (TAP) buffer [50 mM tris-HCl (pH 7.9), 100 mM KCl, 5 mM MgCl2, 10% glycerol, 0.1% NP-40, 1 mM dithiothreitol (DTT), and protease inhibitors] for 4 hours and three times washing with TAP buffer. Proteins were eluted with Flag peptides. A second purification was performed using anti-HA–conjugated agarose beads (Santa Cruz Biotechnology, sc-7392), followed by elution with HA peptides. For mass spectrometry, the sample was TCA-precipitated and peptides were identified via liquid chromatography–tandem mass spectrometry at the Taplin Core facility/Harvard Medical School.

Stielow B., Zhou Y., Cao Y., Simon C., Pogoda H.M., Jiang J., Ren Y., Phanor S.K., Rohner I., Nist A., Stiewe T., Hammerschmidt M., Shi Y., Bulyk M.L., Wang Z, & Liefke R. (2021). The SAM domain-containing protein 1 (SAMD1) acts as a repressive chromatin regulator at unmethylated CpG islands. Science Advances, 7(20), eabf2229.

+ Open protocol

+ Expand

Co-Immunoprecipitation Assay Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Co-IP was performed essentially as described previously^{4 (link)}. Cells were lysed in cell lysis buffer containing 50 mM Tris-HCl pH 7.4, 250 mM NaCl, 0.5% Triton X-100, 10% glycerol, 1 mM DTT, and a complete protease inhibitor tablet (Roche). Antibodies conjugated with protein A/G beads (Millipore) or anti-FLAG M2-conjugated agarose beads (Sigma) were incubated with the lysates overnight at 4°C. The beads were then washed 3–6 times with cell lysis buffer, and the bound proteins were eluted in SDS buffer and analyzed by Western blotting.

Wan L., Wen H., Li Y., Lyu J., Xi Y., Hoshii T., Joseph J., Wang X., Loh Y.H., Erb M.A., Souza A.L., Bradner J.E., Shen L., Li W., Li H., Allis C.D., Armstrong S.A, & Shi X. (2017). ENL links histone acetylation to oncogenic gene expression in AML. Nature, 543(7644), 265-269.

+ Open protocol

+ Expand

In situ p300-chromatin interaction detection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein-ChIP assays for detection of in situ p300-chromatin interactions was performed as described previously^{40 (link)}. Briefly, cells were cross-linked with 1% formaldehyde for 10 min and stopped with 125 mM glycine. The isolated nuclei were resuspended in nuclei lysis buffer and sonicated. Anti-FLAG M2-conjugated agarose beads (Sigma) were incubated with lysates overnight at 4 °C. The beads were then washed twice, each with low-salt, high-salt and LiCl buffer, and the bound proteins were analyzed by SDS-PAGE and Western blot.

Zhang Y., Xue Y., Shi J., Ahn J., Mi W., Ali M., Wang X., Klein B.J., Wen H., Li W., Shi X, & Kutateladze T.G. (2018). The ZZ domain of p300 mediates specificity of the adjacent HAT domain for histone H3. Nature structural & molecular biology, 25(9), 841-849.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!