RAW264.7 cells were seeded in SensoPlate 96-well glass-bottom plates at 1.5 × 104 cells/well 24 h prior to the experiment. Before the experiment, unlabeled zymosan A particles were incubated with zymosan A opsonizing reagent (rabbit polyclonal IgG; Invitrogen) for 1 h at 37°C. The particles were washed 3 times with PBS and resuspended in RPMI supplemented with 10% FBS. Cell growth medium was replaced with medium containing opsonized zymosan A particles at an MOI of 10. The 96-well plates were centrifuged at 1,000 rpm for 30 s. Cells were incubated at 37°C for 10 min. Next, cells were placed on ice, washed twice with chilled PBS, and stained for 15 min at 4°C for external zymosan A particles with anti-rabbit-Cy3 (JIR). Afterwards, cells were fixed with 4% PFA for 15 min and stained with phalloidin Alexa Fluor 488 for 1 h. The ratio of internalized (blue) beads to attached beads (red beads with clear phalloidin Alexa Fluor 488 signal) was quantified manually.
Rabbit polyclonal igg
Manufactured by Thermo Fisher Scientific
Rabbit Polyclonal IgG is an immunoglobulin G (IgG) antibody produced by immunizing rabbits with a specific antigen. It is purified from the rabbit serum and can be used as a research tool to detect and quantify target proteins in various applications such as Western blotting, ELISA, and immunohistochemistry.
Automatically generated - may contain errors
Lab products found in correlation
Bioruptor, by Diagenode (1 mentions)
Mouse monoclonal igg, by Thermo Fisher Scientific (1 mentions)
Bx51 microscope, by Nikon (1 mentions)
Background punisher, by Biocare Medical (1 mentions)
Betazoid dab chromogen kit, by Biocare Medical (1 mentions)
Peroxidazed, by Biocare Medical (1 mentions)
Diva decloaker, by Biocare Medical (1 mentions)
Rabbit on farma hrp polymer, by Biocare Medical (1 mentions)
Enspire multimode reader, by PerkinElmer (1 mentions)
Polyclonal goat igg, by R&D Systems (1 mentions)
Mda 5 d74e4, by Cell Signaling Technology (1 mentions)
Rig 1 d14g6, by Cell Signaling Technology (1 mentions)
5 protocols using rabbit polyclonal igg
1
Phagocytosis Assay of Opsonized Zymosan
2
ChIP-qPCR Analysis of C/EBPβ Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C2C12 myoblasts were crosslinked with 1% formaldehyde for 30 min then sonicated for 30 cycles (30 sec ON/OFF) using Diagenode Bioruptor®. Equal amounts of chromatin was used to perform Immunoprecipitation (ChIP) analysis as previously described23 (link) using C/EBPβ (C-19, Santa Cruz Biotech, Sc-150) or rabbit polyclonal IgG (Invitrogen). Data are presented as copy numbers as compared to a standard curve that was generated using 10% input of each sample. The primer sequences used are as followed: Id3_−26kb (chr4: 135, 672, 285-135, 674, 188) F:GGCTGTTCGTTGACCTTGTTT R: AGGGAATCGTGACGGTTGG, Id3_−20 kb (chr4: 135, 678, 270-135, 680, 185) F: TTCGAAAGGCTTCCGGGCTAA R: TCCCTGCGACCCAAAGCTTAC, Id3_promoter (chr4: 135, 698, 261-135, 700, 171) F: AGTTCTCGGTGGAAACGGTC R:CTAGGCGCTGAGATTGCAGA, Id1_promoter (chr2: 152, 736, 188-152, 736, 308) F: TTTGAACGTTCTGAACCCGC R: GGCTGAGAACAGAGTGTGGG, Negative region (chr11: 71, 360, 398-71, 360, 930) F: TCCCAGCTCACAGGCTAGAA R: AATGCAGAGCAGAAGGGGTC.
3
Multicolor Immunofluorescence for Pathogen Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After antigen retrieval and blocking, the sample was incubated with mouse anti-talin antibody (1:500) and vinculin recombinant rabbit monoclonal antibody (1:500) for 2 h before incubated with Alexa Fluor 488-conjugated goat anti-mouse IgG (1:2000) and Alexa Fluor 594-conjugated goat anti-rabbit IgG (1:2000) for 1 h. The rickettsia infected sample was incubated with rickettsia rabbit antibody (1:2000) for 2 h before incubation with Alexa Fluor 594-conjugated goat anti-rabbit IgG (1:2000) for 1 h. The Ebola infected sample was incubated with Ebola rabbit antibody (1:500) for 2 h before incubation with Alexa Fluor 594-conjugated goat anti-rabbit IgG (1:2000) for 1 h. A mouse monoclonal IgG (Thermo Fisher) or Rabbit Polyclonal IgG (Thermo Fisher) served as a negative control [29 (link)]. Fluorescent images were taken and analyzed using an Olympus BX51-microscope or using a Nikon A1R MP ECLIPSE Ti Confocal, with NIS-Elements imaging software version 4.50.00 (Nikon, Tokyo, Japan).
4
Quantifying DKK1 Protein Levels in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DKK1 ELISAs were conducted using a Human DKK1 ELISA kit (Abcam: ab100501). Supernatants from each of the cell lines were analyzed in duplicate following the manufacturer’s protocol. Assay plates were read at 450 nm using the EnSpire Multimode Reader (PerkinElmer). A standard curve was generated using a four-parameter logistic regression fit. The amount of DKK1 was normalized to viable cell number which was determined prior to harvesting the supernatant. DKK1 IHC was performed at StageBio (Worcester, MA). FFPE CPA slide sections were subjected to high temperature antigen retrieval with DIVA Decloaker (Biocare Medical), followed by endogenous peroxidase blockade with Peroxidazed (Biocare Medical) and nonspecific protein binding blockade with Background Punisher (Biocare Medical). Subsequently, sections were incubated at room temperature for 2 h with an anti-DKK1 antibody (Cell Signaling: 4687) or a rabbit polyclonal IgG (Thermo-Fisher: 02-6102) at a concentration of 1.0 mg/mL. After washing, slides were incubated with a Rabbit-on-Farma HRP-Polymer (Biocare Medical) at room temperature for 30 min, washed, and developed for 5 min with a Betazoid DAB chromogen kit (Biocare Medical).
5
Comprehensive Antibody Protocol for Cytometry and Western Blotting
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!