Rg088s

The procedure was performed according to the manufacturer’s instructions (RG088S, Beyotime, China). Briefly, HEK293T cells were transfected with ERα plasmid or its empty vector control in combination with pTGF-βR1-Luc reporter construct, pRL-TK, and E₂ and incubated for 48 h. Next, the cells were lysed using the detection buffer for 15 min. The supernatant of the lysate was used to measure the expression of the luciferase reporter gene. The activity of pTGF-βR1-Luc was normalized with the transfection efficiency using the activity of Renilla luciferase (pRL-TK). To generate luciferase reporter plasmids of TGF-βRIpromoter, DNA fragments (predicted ERE sequence: TCAAATTTAGTCTCTGTAGCCTCGGTGC; Mut ERE sequence: TCTTAACTCATGACAGTACGTATCTCGGTGC) were synthesized and inserted into the pGL3 basic luciferase expression vector (Promega, Madison, WI, USA). HEK293T cells were transfected using luciferase reporter plasmids. The luciferase activity reflected the transcriptional activity of the target genes. To assay the luciferase activity, cell extracts were detected on the Dual-Luciferase Reporter (DLR) assay system (Promega).

The 3′UTR of MTDH sequence of the site binding to miR-9-3p was inserted into a pmirGLO dual-luciferase vector with XhoI and XbaI double digestion to construct the generative wildtype (WT) MTDH. The Site-Directed Mutagenesis Kit was used to synthesize the mutant (MUT) MTDH sequence and then inserted into the pmirGLO dual-luciferase vector with XhoI and XbaI double. Next, the pmirGLO vector containing WT or MUT MTDH sequence was respectively co-transfected with miR-9-3p mimic into HEK293T cells using Lipofectamine 2000 (Invitrogen, USA). After incubation for 48 h, a dual-luciferase reporter gene detection kit (RG088S, Beyotime Biotechnology, China) was used to measure the relative luciferase activity of the cells.

Jefferson software (http://www.jefferson.edu/) was used to predict the possible binding site of miR-340-5p with the TNFSF8 3′UTR. The TNFSF8 wild-type (Wt) and mutant (Mt) 3′-UTR sequences were synthesized and inserted into a psiCHECK2 plasmid to produce a wild-type TNFSF8 (WT-TNFSF8) luciferase reporter plasmid and mutant TNFSF8 (mut-TNFSF8) luciferase reporter plasmid. Subsequently, a miR-483-5p mimic or mimic-NC was cotransfected with the WT-TNFSF8 reporter or Mut-TNFSF8 reporter plasmid using a Lipofectamine 3000 kit (Invitrogen, Cat. 11668-027, CA, USA). After 48 h, the luciferase activity was measured using a dual-luciferase reporter assay kit (Beyotime, Cat. RG088S, Shanghai).