HCC cells were cross-linked with 1% formaldehyde for 10 min at room temperature before the ChIP assay. The EZ-Magna ChIPTM Chromatin Immunoprecipitation Kit was purchased from Millipore for the ChIP assay. According to the manufacturer's instructions, proteins were cross-linked with 1% formaldehyde after cell lysis and DNA shearing with 15 cycles of sonication. Next, immunoprecipitation was conducted using the GLI1 antibody (Cell Signaling Technology, Danvers, MA, USA), normal rabbit IgG (Santa Cruz) as a negative control (IgG group) and anti-RNA Polymerase II antibody as the positive control (Input group). Following immunoprecipitation, cross-links were removed and immunoprecipitated DNA was purified and then amplified by qRT-PCR using the SYBR Green PCR Master Mix (Applied Biosystems). The primers used to detect the CtBP2 promoter were designed as follows: Forward: 5′-GCCGAACTCAGGGTAGTGAG-3′; Reverse: 5′-CGT CCTGACGTCTCAAGGTT-3′.
Ez magna chip chromatin immunoprecipitation kit
Manufactured by Merck Group
Sourced in United States, Germany
The EZ-Magna ChIP Chromatin Immunoprecipitation Kit is a laboratory product designed for chromatin immunoprecipitation (ChIP) assays. The kit provides the necessary reagents and protocols to perform ChIP experiments, which are used to analyze protein-DNA interactions within a cellular context.
Automatically generated - may contain errors
Lab products found in correlation
Ab32106, by Abcam (2 mentions)
Gli1 antibody, by Cell Signaling Technology (1 mentions)
Normal rabbit igg, by Santa Cruz Biotechnology (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
P stat3 antibody, by Cell Signaling Technology (1 mentions)
Anti hif 1α antibody, by Abcam (1 mentions)
Anti rna polymerase 2 antibody, by Merck Group (1 mentions)
Chipab h3k27me3, by Merck Group (1 mentions)
Bioruptor ucd 200, by Diagenode (1 mentions)
Protein a g magnetic beads, by Merck Group (1 mentions)
Anti e2f1, by Merck Group (1 mentions)
Anti suv39h1, by Abcam (1 mentions)
Bioruptor, by Diagenode (1 mentions)
Ab227383, by Abcam (1 mentions)
Ab172730, by Abcam (1 mentions)
Anti jun antibody, by Santa Cruz Biotechnology (1 mentions)
Ab264350, by Abcam (1 mentions)
Anti egr1, by Cell Signaling Technology (1 mentions)
Ab185637, by Abcam (1 mentions)
26 protocols using ez magna chip chromatin immunoprecipitation kit
1
ChIP-qPCR Analysis of GLI1 Binding to CtBP2 Promoter
2
ChIP to Detect p-STAT3 Binding SNAI1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The regulatory effect of p-STAT3 on the transcription of SNAI1 was determined by chromatin immunoprecipitation (ChIP) of HCC cells fixed with 1% formaldehyde at room temperature using the EZ-Magna ChIPTM Chromatin Immunoprecipitation Kit (Millipore, USA). The p-STAT3 antibody was obtained from Cell Signaling Technology. The primers used for detecting whether p-STAT3 protein was bound to the SNAI1 promoter were Forward 5'-AGGGGATTGGAGAATTGCATGT-3' and Reverse 5'- CTGGGGGATGCAGCATTTTC-3'. The 282 bp product was separated by electrophoresis and visualized on a 2% agarose gel.
3
ChIP Assay with SND1 Antibody
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed using the EZ-Magna-ChIP™-Chromatin Immunoprecipitation Kit (EMD Millipore) according to the manufacturer’s protocol. Immunoprecipitation was performed with the anti-SND1 antibody (8 μg; Abcam) and anti-IgG antibody (8 μg; Sigma, St Louis, MO, USA). The purified immunoprecipitated DNA samples were used in PCRs. Primers were synthesized by Sangon Biotechnology Co. Ltd. (Shanghai, People’s Republic of China). PCR products were resolved electrophoretically on a 2% agarose gel and visualized by ethidium bromide staining. qPCR was also used to detect the purified immunoprecipitated DNA samples.
4
HIF-1α Chromatin Immunoprecipitation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assays were performed using the EZ-Magna ChIP Chromatin Immunoprecipitation Kit (Merck Millipore, Burlington, MA, USA). Chromatin from HK-2 and TCMK-1 cells was immunoprecipitated with an anti-HIF-1α antibody (#ab14179, Abcam, Cambridge, UK). An anti-RNA polymerase II antibody (Merck Millipore) was used as a positive control, and IgG (Merck Millipore) was used as a negative control.
5
Chromatin Immunoprecipitation Assay for ELK1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation assay Chromatin immunoprecipitation (ChIP) assays were carried out using the EZ-Magna ChIP Chromatin Immunoprecipitation Kit (17-10086, Merck) . Brie y, the MDA-MB-231 and MDA-MB-468 cells were crosslinked with 1% formaldehyde for 10 min at room temperature before immunoprecipitation reaction. After incubation with 5 μl anti-ELK1 antibody (ab32106, Abcam) or IgG antibody (rabbit anti-IgG, as the negative control) and protein A/G magnetic beads overnight, immunoprecipitation was performed in accordance with the manufacturer's instructions. Co-precipitated DNA was quanti ed using qPCR. A volume of 10 μl chromatin was used as input control prior to immunoprecipitation. This experiment was repeated three times.
6
Chromatin Immunoprecipitation Assay for ELK1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation assay Chromatin immunoprecipitation (ChIP) assays were carried out using the EZ-Magna ChIP Chromatin Immunoprecipitation Kit (17-10086, Merck) . Brie y, the MDA-MB-231 and MDA-MB-468 cells were crosslinked with 1% formaldehyde for 10 min at room temperature before immunoprecipitation reaction. After incubation with 5 μl anti-ELK1 antibody (ab32106, Abcam) or IgG antibody (rabbit anti-IgG, as the negative control) and protein A/G magnetic beads overnight, immunoprecipitation was performed in accordance with the manufacturer's instructions. Co-precipitated DNA was quanti ed using qPCR. A volume of 10 μl chromatin was used as input control prior to immunoprecipitation. This experiment was repeated three times.
7
ChIP-qPCR Analysis of H3K27me3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An EZ-Magna ChIP™ Chromatin Immunoprecipitation kit (Cat#17-10086, Millipore) was used to perform ChIP experiments. Then, 1% formaldehyde was added to the cells (3 × 106/ChIP) for 10 min to achieve in vivo cross linking. Sonication (30 s ON/OFF for 10 min in a Bioruptor UCD-200, Diagenode) of the cross-linked chromatin was performed to generate <500 bp DNA fragments. Chromatin supernatant (1%) was collected as the input before adding the following immunoprecipitating antibodies: ChIPAb + H3K27me3 (Cat#17-622, Millipore) or mouse IgG (Cat#12-371B, Millipore). Magnetic Protein A/G Beads (Cat# CS204457, Millipore) were used to bind the antibody/antigen/DNA complex. ChIP samples were washed, crosslinks were reversed, and ChIP DNA was isolated as the template for real-time qPCR using SYBR Green. To assess the occupancy of H3K27me3 on the promoter regions of the SLITRK4, PITPNC1, and PPARG genes, the primers are listed in Supplementary Table 5 .
8
Probing Smad2/3 Binding to NKILA Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549 cells treated with PBS or recombinant TGF-β1 for 30 min were used to perform chromatin immunoprecipitation assay (ChIP) using an anti-Smad2/3 antibody (CST) and the EZ-Magna ChIP Chromatin Immunoprecipitation kit (Millipore) according to manufacturer’s instructions. The chromatin fraction isolated by ChIP was analyzed by qRT-PCR with specific primers for the promoter area of NKILA.
9
ChIP Assay of miR-21 Promoter Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays of miR-21 promoter in RAW264.7 cells were performed using EZ-Magna ChIP Chromatin Immunoprecipitation kit (Millipore, USA) according to the instruction. The cells treated with LPS and genistein were fixed in 1% formaldehyde at room temperature for 10 min. Fixation was stopped by addition of 1/10 vol 1.25 M glycine, and then the cells were incubated for 5 min at room temperature, lysed and sonicated (3 min, 10 s on, 20 s off) to 200∼500 bp fragments. The crosslinked chromatin DNA was immunoprecipitated with anti-NF-κB p65 and Normal IgG. qPCR was applied to detect ChIP DNA. Primers for detecting p65 enrichment at miR-21 promoter were as follows, Forward: TCTCCAAGCCAGAACAAGGA; Reverse: ATTTCGGTTCGGCTTTCTCG.
10
ChIP Assay for Transcription Factor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation assays were conducted using an EZ-Magna ChIP chromatin immunoprecipitation kit (17-371RF, Millipore) according to the manufacturer’s instructions. Briefly, after fixation in 1% formaldehyde for 10 min at room temperature, 5 × 106 cells were collected, lysed, and sonicated. Antibodies against p65 (5 μL mg−1 protein) and rabbit IgG (2 μL mg−1 protein) were used for immunoprecipitation. Bound DNA fragments were subjected to real-time PCR. The primer sequences used in the ChIP assays are provided in Additional file 1 : Table S3.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!