C jun antibody

c-JUN CUT&Tag data was generated by the Hyperactive Universal CUT&Tag Assay Kit (Vazyme) according to the manufacturer’s instructions. H1 cells (1 × 10⁵) were used for the CUT&Tag experiment, and pA-Tn5 transposase was used to cut the genome and add a special adaptor sequence to build a library. The enrichment of target sites in the library was detected using qPCR. The c-JUN antibody was purchased from Cell Signaling Technology (#9165; Cell Signaling Technology).

c-JUN CUT&Tag data was generated by the Hyperactive Universal CUT&Tag Assay Kit (Vazyme) according to the manufacturer’s instructions. H1 cells (1 × 10⁵) were used for the CUT&Tag experiment, and pA-Tn5 transposase was used to cut the genome and add a special adaptor sequence to build a library. The enrichment of target sites in the library was detected using qPCR. The c-JUN antibody was purchased from Cell Signaling Technology (#9165; Cell Signaling Technology).

We performed ChIP on 4–5 × 10⁶ MDA-LM2 or SUM-LM1 cells using the PierceTM Magnetic ChIP Kit (ThermoFisher Scientific) according to manufacturer’s instructions with 10 µg rabbit IgG isotype control or c-Jun antibody (Cell Signaling). Primers for ChIP-qPCR were designed flanking known consensus and tracked AP-1/c-Jun binding sites in proximity to IL1A and IL1B promoter regions, as recognized by the USCS Genome Browser^{52 (link)}. Primer sequences used for SYBR green (Applied Biosystems) qPCR are provided in Supplementary Table 5. qPCR was analyzed with the Viia 7 Real-Time PCR System (Applied Biosystems).

c-Jun antibody (#9165) and GAPDH antibody (#2118) were purchased from Cell Signaling, anti-Flag antibody (F1804) was purchased from Sigma-Aldrich. For gene knockdown, the shRNA sequence for scrambled shRNA is GGTGTATGGGCTACTATAGAA, others plasmids were purchased from sigma including ABL1 (TRCN0000039898), ABL2 (TRCN0000218815) and JUN (TRCN0000039590 and TRCN0000039591). To construct the human JUN ectopic expression plasmid, pcDNA3.1-JUN, a full-length human JUN cDNA was cloned from LM2 cDNA. pGL3-AP1-Luc containing 3× c-Jun binding motif (AP1) was purchased from addgene. The TNC promoter sequence (−1054 to +246 bp related to TSS) was cloned from DNA of LM2 cells, and inserted into the pGL3-vector. To generate the TNC-mutation promoter, multiple site-directed mutagenesis was used to introduce mutations into wild-type TNC promoter.

The ChIP assay was performed according to the instructions using the SimpleChIP™ enzymatic chromatin IP kit (Cell Signaling Technology). Cells were seeded on a 100 mm culture dish at 1 × 10⁵ cells/mL. At 16 h after seeding, cells were treated with BDB (30 μM). After 1 h, the cells were exposed to UVB at a dose of 30 mJ/cm². After 24 h, the cross-linked chromatin was digested with nuclease according to the instructions, and the c-Jun antibody (Cell Signaling Technology) and the rabbit IgG (Cell Signaling Technology) were added to the chromatin digests. The protein G magnetic beads were added, the immuno-precipitated complexes were eluted with buffer, proteinase K was added and the solution was incubated at 65 °C for 2 h. The immuno-precipitated DNA fragments were purified on spin columns and the recovered DNA was subjected to 35 cycles of PCR. The primers for the MMP-1 gene promoter (−67 to +94 of the MMP-1 gene sequence from the transcription starting site, Bionics) were designed as follows: sense 5′-CCTCTTGCTGCTCCAATATC-3′ and antisense 5′-TCTGCTAGGAGTCACCATTTC-3′. The PCR products were separated on agarose gel, DNA bands were stained and analyzed with Image software.