The largest database of trusted experimental protocols

Rna to cdna premix

Manufactured by Takara Bio

The RNA to cDNA premix is a reagent kit designed for the reverse transcription of RNA to complementary DNA (cDNA). It contains all the necessary components, such as reverse transcriptase enzyme, buffer, and primers, to efficiently convert RNA into cDNA in a single-step reaction.

Automatically generated - may contain errors

2 protocols using rna to cdna premix

1

RNA Isolation and qPCR Analysis of T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from purified T cells with RNeasy Plus Micro Kit (QIAGEN). The isolated RNA was transcribed into cDNA using the using the RNA to cDNA premix (Clontech) according to the manufacturer’s instructions. SYBR green was purchased from Roche, and the assays were performed on 96-well reaction plates (Invitrogen). The real-time PCR was performed on StepOnePlus system (Invitrogen). In all experiments, β-actin was used as reference gene to normalize gene expression. Primers are shown in Supplemental Table 2.
+ Open protocol
+ Expand
2

Quantitative RT-PCR Analysis of T-Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from T cells with RNAeasy Plus micro kit (QIAGEN). The isolated RNA was transcribed into cDNA using the RNA to cDNA premix (Clontech) according to the manufacturer’s instructions. SYBR green were purchased from Roche and the assays were performed on 96-well reaction plates (Life Technologies). The real time PCR was performed on StepOnePlus system (Life Technologies). In all experiments β-actin was used as a reference gene to normalize gene expression. Mouse β-actin (Forward: CTAAGGCCAACCGTGAAAAG; Reverse: ACCAGAGGCATACAGGGACA), PPP2R2A (Forward: AAGGTGGGAGAGTTGTCATCTT; Reverse: AGCTTTTCAAGTAGTCAAATTCTGG), IFN-γ (Forward: CTCTTCCTCATGGCTGTTTCT; Reverse: TTCTTCCACATCTATGCCACTT), IL-17A (Forward: TCCAGAAGGCCCTCAGACTA; Reverse: AGCATCTTCTCGACCCTGAA), T-bet (Forward: TCAACCAGCACCAGACAGAG; Reverse: AAACATCCTGTAATGGCTTGTG), RORC (Forward: ACCTCTTTTCACGGGAGGA; Reverse: TCCCACATCTCCCACATTG) primers were used.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!