Bamhi and xhoi

To generate a TCR α and β co-expression plasmid, the C-region of TCRα and β chain were first amplified from cDNA from wild type splenocytes and ligated into the pMX-IP vector (Cell Biolabs). Pd-reactive T cells were collected, RNA extracted using the RNeasy mini kit (QIAGEN), and then cDNA synthesized using Superscript III (ThermoFisher Scientific). The cDNA was then used to generate TCRα and β libraries as described previously (21 (link)). Each TCR library was mixed with a forward primer consisting of the annealing site of the adapter DNA (5’- AGCTAGTTAATTAAGGATCCTGATCACCGGACAGGAATTCC -3’) and 20 bps overlapping the pMX-IP vector and a reverse primer specific for the C-region of the TCR α and β (for TCRα 5’- TGGTACACAGCAGGTTCTGGGTTC-3’, for TCRβ 5’- CAAGGAGACCTTGGGTGGAGTCAC-3’). Next, TCR fragments were amplified by PCR. PCR fragments were ligated into the pMX-IP vector digested with BamHI and XhoI (TakaraBio) by mix with NEBuilder HiFi DNA Assembly Master Mix (New England Bio. Lab.) and incubation at 50°C for 15 min. The resulting vectors were transformed into NEB5α competent cells. Transformed cells were spread on LB agar plates and incubated for 16 hours at 37°C. Colonies were then collected, and mixed plasmids were purified using a QIAGEN miniprep kit.

E. coli DH5α and pMD 18-T vectors for gene cloning and E. coli BL21 (DE3) and pET-28a (+) for gene expression of endo-β-1,4-xylanase were preserved in our laboratory. Restriction endonucleases BamH I and Xho I, PrimeSTAR^® HS DNA polymerase, and T4 DNA ligase were purchased from TaKaRa (Tokyo, Japan). The substrates pNP-α-d-arabinofuranoside (pNPA), pNP-β-d-xylopyranoside (pNPX), pNP-α-d-glucopyranoside (pNPGα), pNP-β-d-glucopyranoside (pNPGβ), carboxymethyl cellulose (CMC), and Avicel, as well as xylans from beechwood, birchwood, oat spelt, and corncob, were purchased from Sigma Chemical Company (St. Louis, MO, USA). All other chemicals used in the present study were of analytical grade.