Nanog antibody

Manufactured by Cell Signaling Technology

Sourced in United States, China

The NANOG antibody is a laboratory reagent used in research applications. It is a highly specific antibody that can be used to detect the presence and measure the levels of the NANOG protein, which is a key transcription factor involved in the regulation of embryonic stem cell self-renewal and pluripotency.

Automatically generated - may contain errors

Lab products found in correlation

Chip assay kit, by Merck Group (1 mentions) Vcx130, by Sonics (1 mentions) Taz antibody, by Cell Signaling Technology (1 mentions) Chemidoc xr, by Bio-Rad (1 mentions) Bca protein assay kit, by Keygen Biotech (1 mentions) Bcl 2 antibody, by Abcam (1 mentions) Sox2 antibody, by Proteintech (1 mentions) β actin, by Proteintech (1 mentions) Oct4 antibody, by Abcam (1 mentions) Bax antibody, by Proteintech (1 mentions) C myc antibody, by Santa Cruz Biotechnology (1 mentions) Hrp conjugated secondary antibody, by Cell Signaling Technology (1 mentions) β catenin antibody, by Cell Signaling Technology (1 mentions) Gapdh antibody, by Proteintech (1 mentions) Ecl plus, by Merck Group (1 mentions) Live cell imaging system, by Molecular Devices (1 mentions)

Spelling variants of this product

Nanog (245 citations) Anti-NANOG antibody (7 citations) Rabbit anti-Nanog antibody (2 citations)

4 protocols using nanog antibody

ChIP Assay of Mechanosensitive Stemness Factors

Check if the same lab product or an alternative is used in the 5 most similar protocols

CHIP assay was carried out using the ChIP Assay Kit (Merck Millipore) according to the kit’s instruction. In brief, MCF-7 cells were cultured on soft or stiff hydrogels for 2 weeks. MCF-7 cells (5 × 10⁶) were crosslinked with 1% formaldehyde for 10 min at room temperature. Then samples were lysed and sonicated to shear chromatin DNA with an Ultrasonic Processor (Sonics VCX130) for 10 cycles (50% amplitude, 10 s on and 20 s off). The chromatin was incubated with TAZ antibody (1:50, clone: E9J5A, cat# 72804, Cell Signaling Technology), NANOG antibody (1:25, cat# 3580, Cell Signaling Technology), or IgG overnight at 4 °C. Then the captured chromatin was eluted, crosslinks reverted. The DNA sample was subjected to PCR analysis using the following primers:
Sox2 promoter forward: 5′- GCGTCCCATCCTCATTTAAG -3′
Sox2 promoter reverse: 5′- AGCAACAGGTCACACCACAC -3′
Pou5f1 promoter forward: 5′- TTGGGGAGCAGGAAGCAGTC -3′
Pou5f1 promoter reverse: 5′- GACAATGGCCTTGGCTGGAC -3′

Liu X., Ye Y., Zhu L., Xiao X., Zhou B., Gu Y., Si H., Liang H., Liu M., Li J., Jiang Q., Li J., Yu S., Ma R., Su S., Liao J.Y, & Zhao Q. (2023). Niche stiffness sustains cancer stemness via TAZ and NANOG phase separation. Nature Communications, 14, 238.

+ Open protocol

+ Expand

Protein Expression Profiling of Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The experimental group was defined using a predetermined experimental drug concentration (single or combination), while the drug-free medium was defined as a control group, with each group acting on the cells for 48 hours. After treatment, cells were collected for lysis. Protein concentration was determined using the bicinchoninic acid (BCA) Protein Assay Kit (Keygen, Nanjing, China). Samples of 20 µg of protein were collected, resolved in a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to a polyvinylidene fluoride (PVDF) membrane. Then, 5% blocking buffer [5% skimmed milk powder + tris-buffered saline with Tween 20 (TBST)] was applied to the membrane for 60 minutes at room temperature. Subsequently, the membrane was incubated with primary antibodies, including Sox2 antibody (Proteintech, 11064-1-AP), Oct4 antibody (Abcam, Cambridge, UK; ab200834), beta-actin (Proteintech, 66009-1-Ig), Bcl2 antibody (Abcam, mab182858), Bax antibody (Proteintech, 50599-2-Ig), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (Proteintech, 10494-1-AP), Nanog antibody [Cell Signaling Technology (CST), Danvers, MA, USA; 4903T] overnight at 4 ℃. The next day, secondary antibodies were added and the membranes were washed and visualized using ChemiDoc TMXRS+ (Bio-Rad, Hercules, CA, USA) after 60 minutes of incubation at room temperature.

Huang P., Li H., Ren L., Xie H., Chen L., Liang Y., Hu Y., Selistre-de-Araujo H.S., Boussios S., Jhawar S.R., Cui R., Zuo Q, & Chen Q. (2023). Astragaloside IV enhances the sensitivity of breast cancer stem cells to paclitaxel by inhibiting stemness. Translational Cancer Research, 12(12), 3703-3717.

+ Open protocol

+ Expand

Western Blot Analysis of Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole‐cell lysates were prepared in modified RIPA buffer; proteins were separated by SDS/PAGE and transferred onto PVDF membranes, which were incubated with primary antibodies. HRP‐conjugated secondary antibodies (Cell Signaling) were used. Chemiluminescent signals were detected using ECL Plus (Millipore, Temecula, CA, USA). CRB3 antibody (1:500, #292449) and cMyc antibody (1:500, #764) were purchased from Santa Cruz (Dallas, Texas); OCT4 antibody (1:1000, WL1005a) was purchased from Wanleibio (Shenyang, China); β‐catenin antibody (1:1000, #8480), NANOG antibody (1:1000, #4903), CD44 (1:1000, #3570) were purchased from Cell Signaling; and GAPDH antibody (1:10 000, HRP‐60004) was obtained from Proteintech (Wuhan, China).

Li P., Feng C., Chen H., Jiang Y., Cao F., Liu J, & Liu P. (2018). Elevated CRB3 expression suppresses breast cancer stemness by inhibiting β‐catenin signalling to restore tamoxifen sensitivity. Journal of Cellular and Molecular Medicine, 22(7), 3423-3433.

+ Open protocol

+ Expand

Immunofluorescence Staining of Reprogrammed Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells or reprogramming colonies were fixed with 4% paraformaldehyde (PFA) at room temperature (RT) for 20 min, and then permeabilized with 0.5% Triton X-100 in DPBS at RT for 30 min. Samples were blocked with blocking buffer (5% normal goat serum (NGS), 0.3% Triton X-100 in DPBS) at RT for 1 hour. Primary antibody incubation was performed at 4°C overnight. Antibody was diluted with antibody buffer (1% BSA, 0.3% Triton X-100 in DPBS). After washing, samples were then incubated with secondary antibody prepared with antibody buffer at RT for 1 hour. For micropatterning, images were taken under a confocal microscope. For iPS colony quantification, images were taken with the live cell imaging system (Molecular Devices). Nanog antibody: Cell Signaling, 4903 (1:200); MKL1 antibody: a gift from Topher Carroll.

Hu X., Wu Q., Zhang J., Chen X., Hartman A.A., Eastman A.E., & Guo S. (2020). Reprogramming progressive cells display low CAG promoter activity.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!