Gene amp 2400 pcr system

RAPD Amplification was performed with extracted and purified genomic DNA from nine genomes of Ocimum using ten RAPD primers (Genei, Pvt. Ltd., Bangalore, India). Primers were selected in the present study on the basis of previous works on Ocimum species [21] , [31] . Each RAPD PCR were performed in 25 μL volume containing 25 ng genomic DNA as template, 2.5 μL PCR Assay buffer, 200 μM dNTP mix, 1.0 mM MgCl₂, 0.5 μL Taq DNA polymerase and 1 μM of each primer (Genei, Pvt. Ltd., Bangalore, India). Amplification reactions were performed with an initial denaturation at 94 °C for 4 min, following the initial steps, PCR was carried out for 35 cycles of 15 s denaturation at 94 °C, followed by primer annealing for 15 s at 40 °C and an extension step of 1.15 min at 72 °C. The last cycle was followed by final extension of 72 °C for 7 min using thermal cycles (Perkin Elmer gene Amp 2400 PCR system).
The PCR amplified products were separated by electrophoresis at a constant voltage of 70 V for 1.5 h in 1× TAE (Tris Acetate EDTA) buffer and resolved on 1.5% agarose gel stained with ethidium bromide. The gel was visualized in a UV-transilluminator and photographed in Gel Doc System (Biorad). A low range DNA ladder (100–3000 bp) (Genei, Pvt. Ltd., Bangalore, India) was used as known molecular weight marker.

PCR amplifications of genomic DNA with RAPD primers (Genni, Bangalore, India) were used with minor modification of Williams et al. (1990) (link). PCR reaction mixture was 25 μl containing 1 unit of PCR buffer (Genni, Bangalore, India), 200 μM dNTPs, 1 unit (U) Taq DNA polymerase, 50 ng template DNA, 1.0 μM of each primer (Genni, Bangalore, India) and 2.0 mM MgCl₂. The amplification reaction consisted of an initial denaturation step at 94 °C for 4 min, followed by 40 cycles of 15 s denaturation at 94 °C, 15 s annealing at 40 °C, 1.15 min extension at 72 °C with a final extension of 72 °C for 7 min using thermal cycles (Perkin Elmer gene Amp 2400 PCR system,). The PCR products were resolved by electrophoresis on a 1.5% agarose gel (Himedia, Mumbai, India) in 1.0% tris-acetate EDTA buffer, stained with ethidium bromide (0.5 μg/ml) and visualized under UV light. The number of bands was recorded using a Gel Doc System (Bio-Rad, Hercules, Calif). The size of the amplification products was estimated using a 100–3000 bp DNA ladder (Genni, Bangalore, India).

cDNA was generated from 2 µg of total RNA per sample using the ImProm-II^TM Reverse Transcription System (Promega). A mixture of RNA and 0.5 µg oligo(dT) primer was heated for 5 min at 70°C and incubated for 5 min on ice. Then, the reverse transcription reaction was performed by adding the remnants of the reaction mixture. The reaction was stopped with extension for 1 h at 42°C followed by heating the samples for 15 min at 70°C using the GeneAmp 2400 PCR System (Perkin-Elmer). Two microliters of cDNA was added to the PCR mixture with ×1 PCR buffer, 1.5 mM MgCl₂, 20 pmole primer mix, 1 mM dNTP mix, and 2.5 U Top DNA polymerase (Bioneer). Primer sequences were as follows: Human GAPDH sense AGCCTCCCGCTTCGCTCTCT, antisense CCAGGCGCCCAATACGACCA; and mouse GAPDH sense CTGTTCCAGAGACGGCCGCA, antisense CAGGCGCCCAATACGGCCAA.