Hiseq2500 highoutput

Manufactured by Illumina

The HiSeq2500 HighOutput is a high-throughput sequencing platform designed by Illumina. It is capable of generating large volumes of sequencing data with high accuracy. The system utilizes Illumina's sequencing-by-synthesis technology to perform DNA sequencing.

Automatically generated - may contain errors

Lab products found in correlation

Titanium taq dna polymerase, by Takara Bio (2 mentions) Mag bind blood tissue dna hdq kit, by Omega Bio-Tek (2 mentions) Dntps, by Takara Bio (2 mentions) Flex purification system, by Omega Bio-Tek (2 mentions) Genome analyzer, by Illumina (1 mentions) Bioanalyzer, by Agilent Technologies (1 mentions) Spectrum plant total rna kit, by Merck Group (1 mentions) Hispeed plasmid maxi, by Qiagen (1 mentions) Stbl4 electrocompetent cells, by Thermo Fisher Scientific (1 mentions) Exonuclease 5, by New England Biolabs (1 mentions) Agencourt ampure xp spri beads, by Beckman Coulter (1 mentions) Ampure xp spri beads, by Beckman Coulter (1 mentions) Hiseq 4000, by Illumina (1 mentions) Truseq rna library prep kit, by Illumina (1 mentions)

Spelling variants of this product

HiSeq2500 Highoutput Run V4 (2 citations)

5 protocols using hiseq2500 highoutput

Transcriptome Analysis of Pathogen-Infected Spikelets

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three biological replicates of each genotype and treatment were used for transcriptome analysis. Total RNA was harvested from the infected spikelets at 12 and 48 hpi and also from the mock-inoculated spikelets using Spectrum Plant Total RNA Kit (Millipore Sigma) following manufacturer’s instructions. On column DNase digestion protocol (Millipore Sigma) was performed to remove any residual DNA during the RNA isolation. Three biological replicates for each genotype and treatment were used for transcriptome analysis. TruSeq dual indexed stranded RNA libraries were prepared following the manufacturers guidelines (Illumina). RNA quality and library size were analyzed on a Bioanalyzer (Agilent Technologies). Libraries were sequenced on an Illumina Genome Analyzer using HiSeq 2500 High Output, 50 bp PE flow cell and v4 chemistry at the University of Minnesota Genomics Center. The sequencing files were submitted to NCBI following preliminary analysis (SRA accession PRJNA595999).
Raw data was processed, using the rnaseq2 pipeline available at the gopher-pipelines (https://bitbucket.org/jgarbe/gopher-pipelines/wiki/rnaseq2-pipeline), for quality filtration, adapter trimming and reads mapping using Kallisto. The mapping result output was used for downstream analysis.

Kumar J., Rai K.M., Pirseyedi S., Elias E.M., Xu S., Dill-Macky R, & Kianian S.F. (2020). Epigenetic regulation of gene expression improves Fusarium head blight resistance in durum wheat. Scientific Reports, 10, 17610.

+ Open protocol

+ Expand

Modular Cloning of Barcoded Libraries

Check if the same lab product or an alternative is used in the 5 most similar protocols

The vector pRDA_722 was modified to change the 3′ BbsI module from 6 (with an overhang of ATTC) to module 10 (overhang of TTCG), creating the vector pRDA_792. This enabled the GG reaction to include two additional fragments, a WellBC (with overhangs 6 and 9) and a PlateBC (with overhangs 9 and 10). These two additional fragments were ordered from IDT as two single stranded oligonucleotides and annealed together (see Data S3). Note the WellBCs vary in length to avoid monotemplate reads when assemblies are pooled together.
Fragments were cloned into pre-digested pRDA_792 via Golden Gate cloning in 96-well plates, using a 2:1 M ratio of fragments:destination vector. The ligation products were treated with Exonuclease V (New England Biolabs) in each 96-well plate, then 5 μL from each well was pooled. The pooled product was then isopropanol precipitated and electroporated into Stbl4 electrocompetent cells (Invitrogen) and grown at 30°C for 16 h on agar with 100 μg/mL carbenicillin. Colonies were scraped and plasmid DNA (pDNA) was prepared (HiSpeed Plasmid Maxi, Qiagen). To confirm library representation and distribution, the pDNA was sequenced by Illumina HiSeq2500 High Output. This pool was given the unique identifier CP1915.

McGee A.V., Liu Y.V., Griffith A.L., Szegletes Z.M., Wen B., Kraus C., Miller N.W., Steger R.J., Escude Velasco B., Bosch J.A., Zirin J.D., Viswanatha R., Sontheimer E.J., Goodale A., Greene M.A., Green T.M, & Doench J.G. (2024). Modular vector assembly enables rapid assessment of emerging CRISPR technologies. Cell Genomics, 4(3), 100519.

+ Open protocol

+ Expand

High-Throughput Genomic DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA (gDNA) was isolated using the KingFisher Flex Purification System with the Mag-Bind® Blood & Tissue DNA HDQ Kit (Omega Bio-Tek). The gDNA concentrations were quantitated by Qubit.
For PCR amplification, gDNA was divided into 100 μL reactions such that each well had at most 10 μg of gDNA. Plasmid DNA (pDNA) was also included at a maximum of 100 pg per well. Per 96-well plate, a master mix consisted of 150 μL DNA Polymerase (Titanium Taq; Takara), 1 mL of 10x buffer, 800 μL of dNTPs (Takara), 50 μL of P5 stagger primer mix (stock at 100 μM concentration), 500 μL of DMSO (if used), and water to bring the final volume to 4 mL. Each well consisted of 50 μL gDNA plus water, 40 μL PCR master mix, and 10 μL of a uniquely barcoded P7 primer (stock at 5 μM concentration). PCR cycling conditions were as follows: (1) 95 °C for 1 min; (2) 94 °C for 30 s; (3) 52.5 °C for 30 s; (4) 72 °C for 30 s; (5) go to (2), ×27; (6) 72 °C for 10 min. PCR primers were synthesized at Integrated DNA Technologies (IDT). PCR products were purified with Agencourt AMPure XP SPRI beads according to manufacturer’s instructions (Beckman Coulter, A63880), using a 1:1 ratio of beads to PCR product. Samples were sequenced on a HiSeq2500 HighOutput (Illumina) with a 5% spike-in of PhiX.

DeWeirdt P.C., McGee A.V., Zheng F., Nwolah I., Hegde M, & Doench J.G. (2022). Accounting for small variations in the tracrRNA sequence improves sgRNA activity predictions for CRISPR screening. Nature Communications, 13, 5255.

+ Open protocol

+ Expand

Genomic DNA Extraction and PCR Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA (gDNA) was isolated using the KingFisher Flex Purification System with the Mag-Bind Blood & Tissue DNA HDQ Kit (Omega Bio-Tek). The gDNA concentrations were quantitated by Qubit.
For PCR amplification, gDNA was divided into 100 μL reactions such that each well had at most 10 μg of gDNA. pDNA was also included at a maximum of 100 pg per well. Per 96-well plate, a master mix consisted of 150 μL DNA Polymerase (Titanium Taq; Takara), 1 mL of 10x buffer, 800 μL of dNTPs (Takara), 50 μL of P5 stagger primer mix (stock at 100 μM concentration), 500 μL of DMSO (if used), and water to bring the final volume to 4 mL. Each well consisted of 50 μL gDNA and water, 40 μL PCR master mix, and 10 μL of a uniquely barcoded P7 primer (stock at 5 μM concentration). PCR cycling conditions were as follows: (1) 95°C for 1 min; (2) 94°C for 30 s; (3) 52.5°C for 30 s; (4) 72°C for 30 s; (5) go to (2), x 27; (6) 72°C for 10 min. PCR primers were synthesized at Integrated DNA Technologies (IDT). PCR products were purified with Agencourt AMPure XP SPRI beads according to manufacturer’s instructions (Beckman Coulter, A63880), using a 1:1 ratio of beads to PCR product. Samples were sequenced on a HiSeq2500 HighOutput (Illumina) with a 5% spike-in of PhiX, using a custom oligo (oligo sequence: CTTGTGGAAAGGACGAAACACCGGT AATTTCTACTCTTGTAGAT).

Griffith A.L., Zheng F., McGee A.V., Miller N.W., Szegletes Z.M., Reint G., Gademann F., Nwolah I., Hegde M., Liu Y.V., Goodale A, & Doench J.G. (2023). Optimization of Cas12a for multiplexed genome-scale transcriptional activation. Cell Genomics, 3(9), 100387.

+ Open protocol

+ Expand

RNA-seq Library Preparation and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The quality of the RNA samples was accessed by Agilent Bioanalyzer and only samples with RIN value of >8 were used for library preparation. Library preparation was performed using TruSeq RNA Library Prep Kit (Illumina) according to manufacturer's protocol and sequencing was carried out on Illumina HiSeq 2500 High Output with 2 × 101 bp paired end sequencing or with Illumina HiSeq 4000 with 2 × 151 bp paired end sequencing.

Lim C.K., Efthymios M., Tan W., Autio M.I., Tiang Z., Li P.Y, & Foo R.S.Y. (2021). Dimethyl sulfoxide (DMSO) enhances direct cardiac reprogramming by inhibiting the bromodomain of coactivators CBP/p300. Journal of molecular and cellular cardiology, 160.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!