Top dna polymerase

cDNA was generated from 2 µg of total RNA per sample using the ImProm-II^TM Reverse Transcription System (Promega). A mixture of RNA and 0.5 µg oligo(dT) primer was heated for 5 min at 70°C and incubated for 5 min on ice. Then, the reverse transcription reaction was performed by adding the remnants of the reaction mixture. The reaction was stopped with extension for 1 h at 42°C followed by heating the samples for 15 min at 70°C using the GeneAmp 2400 PCR System (Perkin-Elmer). Two microliters of cDNA was added to the PCR mixture with ×1 PCR buffer, 1.5 mM MgCl₂, 20 pmole primer mix, 1 mM dNTP mix, and 2.5 U Top DNA polymerase (Bioneer). Primer sequences were as follows: Human GAPDH sense AGCCTCCCGCTTCGCTCTCT, antisense CCAGGCGCCCAATACGACCA; and mouse GAPDH sense CTGTTCCAGAGACGGCCGCA, antisense CAGGCGCCCAATACGGCCAA.

The phlG cloning primers (Supplementary Table 1) were designed with P. fluorescens Q2-87 reference sequences currently registered in NCBI [Locus_tag: PflQ2_2239]. The primers were synthesized by Cosmo Genetech (Seoul, Korea). The PCR mixture was 50 μl, comprising 2 mM of dNTPs, 2× PCR Buffer of KOD FX Neo, 1 μg of template DNA, 1.0 U KOD FX Neo, and 0.2 μM of each primer. The PCR reaction was performed as touchdown PCR, whose cycling began with a denaturation and annealing temperature of 83°C for 5 cycles, then reducing the annealing temperature 1°C every 5 cycles to 73°C, followed by 10 more cycles run at 73°C. Each primer was designed to amplify an 882-bp product, and the PCR product identified by gel electrophoresis in 1% agarose. Gel purification was done using Expin Gel SV (GeneAll, Seoul, Korea). To ligate with a donor vector, the purified PCR product underwent an A-tailing reaction (20 μl) as follows; dATP (NEB, Ipswich, MA, USA), 10× Reaction Buffer, and 5 units of TOP DNA Polymerase (Bioneer, Daejeon, Korea); the mixture was treated at 70°C for 30 min. DNA quantification was measured on a NanoDrop 2000C (Thermo Fisher Scientific, Waltham, MA, USA) to confirm its concentration and quality, after which it was stored at -20°C.