The genomic DNA extraction from Bacillus sp. CSK2 was carried out following the previously described method [59 (link)]. The amplification of keratinase encoding gene was done by conventional polymerase chain reaction (PCR) using a set of oligonucleotides; kerBNK1F: TCATCTACTGATTACGTTCC and kerBNK1R: TTAAGAAGCTTTATTTTCTTG as forward and reverse primers, respectively. The pair of primers was designed based on the nucleotide sequence of keratinase-encoding gene of B. thuringiensis (KX155576) available in the GenBank. This isolate is phylogenetically related to Bacillus sp. CSK2. The PCR was carried out using 25 μL reaction mixture that consisted of 12.5 μL of OneTaq® Quick-Load® 2X master mix (New England Biolabs Inc., South Africa), 5.5 μL of nuclease-free water, 1 μL each of both forward and reverse primers and 5 μL of DNA template. The target gene amplification was done by using T100™ Thermal Cycler (Bio-Rad Laboratories Inc., Singapore), under the following cycling conditions: initial denaturation at 95 °C for 5 min, 35 cycles of denaturation at 95 °C for 30 s, annealing at 50 °C for 1 min, extention at 72 °C for 1 min, and then final extention at 72 °C for 5 min. The amplicons were electrophoresed on ethidium bromide stained 1.2% agarose gel (Merck chemicals (Pty) Ltd., South Africa), and subsequently, visualized under ultraviolet trans-illuminator (Uvitec, UK).
Ultraviolet transilluminator
Manufactured by Uvitec
Sourced in United Kingdom
An ultraviolet transilluminator is a laboratory equipment used to visualize and analyze DNA or RNA samples that have been stained with fluorescent dyes. It generates ultraviolet light, which causes the dyed samples to fluoresce, allowing for their detection and examination.
Automatically generated - may contain errors
5 protocols using ultraviolet transilluminator
1
Bacillus sp. CSK2 Keratinase Gene Amplification
2
Amplification and Characterization of Bacillus Keratinase Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene fragment of Bacillus sp. Nnolim-K1 encoding keratinase was amplified by conventional PCR using a set of newly designed oligonucleotides; kerBNK1F: TCATCTACTGATTACGTTCC and kerBNK1R: TTAAGAAGCTTTATTTTCTTG as forward and reverse primers, respectively. The primers were designed by using keratinase gene sequences from the Bacillus cereus group available in the National Center for Biotechnology Information (NCBI) and synthesized by Inqaba Biotechnical Industries (Pty) Ltd., Muckleneuk, Pretoria, Gauteng Province, South Africa. The PCR was carried out using 25 µL reaction mixtures which consisted of 12.5 µL of OneTaq® Quick-Load® 2X master mix (New England Biolabs Inc., Pretoria, South Africa), 5.5 µL of nuclease-free water, 1 µL each of both forward and reverse primers and 5 µL of DNA template. The target gene amplification was done using T100™ Thermal Cycler (Bio-Rad Laboratories Inc., Singapore, Singapore), under the following cycling conditions: initial denaturation at 95 °C for 5 min, 35 cycles of denaturation at 95 °C for 30 s, annealing at 50 °C for 1 min, extension at 72 °C for 1 min, and a final extension at 72 °C for 5 min. The amplicon was electrophoresed on ethidium-bromide-stained 1.2% agarose gel (Merck chemicals (Pty) Ltd., Muckleneuk, Pretoria, Gauteng, South Africa), and subsequently, visualized under an ultraviolet transilluminator (Uvitec, Cambridge, UK).
3
Amplification and Visualization of Bacillus Keratinase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA of Bacillus sp. NFH5 was extracted, as reported previously [23 (link)]. DNA fragment coding for keratinase was amplified by conventional polymerase chain reaction (PCR) using a set of forward primer (kerBANF: TCATCTACTGATTACGTTCC) and reverse primer (kerBANR: TTAAGAAGCTTTATTTTCTTG). The primer pair was designed based on the nucleotide sequence of Bacillus thuringiensis keratinase gene (accession number KX155576) and the isolates' phylogenetic relatedness. The 25 μL reaction mixture, which consisted of 12.5 μL of OneTaq® Quick-Load® 2X master mix (New England Biolabs Inc., South Africa), 5.5 μL of nuclease-free water, 1 μL each of both forward and reverse primers, and 5 μL of DNA template was used for the PCR. The amplification of kerBAN was carried out using T100™ Thermal Cycler (Bio-Rad Laboratories Inc., Singapore), with the following conditions: initial denaturation at 95 °C for 5 min, 35 cycles of denaturation at 95 °C for 30 s, annealing at 50 °C for 1 min, extension at 72 °C for 1 min, and then final extension at 72 °C for 5 min. Subsequently, the amplified DNA fragment was electrophoresed on ethidium bromide-stained 1.2% (w/v) agarose gel (Merck chemicals (Pty) Ltd., South Africa), and the visualization was carried out using an ultraviolet transilluminator (Uvitec, UK).
4
PCR Amplification of DNA Fragment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR reaction included 5 μL of 10 × PCR buffer, 1.5 mM MgCl2, 0.5 mM of each forward (5′-TAACAAGGATTCCCCTAGTA-3′) and reverse (5′-ATTACGCCAGCATCCTAAG-3′) primers [15 (link)], 0.2 mM of each deoxynucleoside triphosphate, 1.25 U of Taq polymerase, and 2 μl template DNA in a final volume of 50 μl. The PCR conditions were as follows: an initial denaturation step at 94°C for 5 min, followed by 34 cycles of denaturation at 94°C for 45 sec, annealing at 55°C for 45 sec, and extension at 72°C for 1 min, with a final extension step of 72°C for 7 min. The PCR products were visualized by 1.5% (w/v) agarose gel electrophoresis in TBE buffer, stained with SYBR Safe DNA gel stain (1 : 10,000 dilution in TBE), and photographed under ultraviolet transilluminator (UVITEC, UK).
5
Inflammation-Related Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR was performed to assess expression of a set of inflammation-related genes including interleukin-6 (IL-6), COX-2 and tumor necrosis factor-a (TNF-a) in the retrieved samples. Briefly, total RNA was extracted from tissue samples using RNeasy Mini Kit (Qiagen, Valencia, USA). Reverse transcription was performed using 2 mg purified RNA and SuperScript TM II Reverse Transcriptase kit (Gibco, New York, USA) in a thermocycler (Eppendorf, Germany). Then, 1 mL of cDNA was admixed with 12.5 mL reaction master mix (Amplicon, Copenhagen, Denmark) and 1 mL of each primer (Table 1). After initial denaturation at 95 C for 10 s, PCR amplification was continued at 95 C for 5 s and 60 C for 30 s for 40 cycles. Finally, dissociation stage was performed at 95 C for 15 s, 60 C for 1 min and 95 C for 15 s. The amplified DNA fragments were electrophoresed on 2% agarose gel and visualized by ultra-violet transilluminator (Uvitec, Cambridge, UK). Expression of each gene was corresponded to TATAAbox-binding protein (TBP) as an internal control. RAW264.7 (Mouse leukemic monocyte macrophage cell line) (Eton Bioscience. Inc. San Diego, CA) was used as a positive control. For semi-quantitative determination, specific band density was normalized to that of the corresponding using AlphaEase software (Genetic Technologies, Inc., Fitzroy Vic 3065 Australia).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!