The DNA fragments encoding the wild type and the mutant human CRNDE were chemically synthesized by Sangon Biotech (Shanghai, China), and separately inserted into pcDNA3.1(+) (pcDNA3.1) expression vector (Invitrogen) after digestion with EcoRI (Takara) and BamHI (Takara). The recombinant plasmids were named as pcDNA-CRNDE and pcDNA-CRNDE-mut, respectively. pcDNA-CRNDE-mut contained mutations of the predicted miR-543 binding site in CRNDE sequence (1008 CTTTA TTG GA TTG AATGAATGTTT 1031, the underlined nucleotides were mutated). The DNA fragments encoding the wild type and the mutant 3′-UTR of human ATG4B mRNA were separately synthesized by Sangon Biotech, digested with SacI (Takara) and SalI (Takara), and then cloned into pmir-GLO reporter vector (Thermo Scientific, Waltham, MA, United States). The reconstructed plasmids were named as pmir-ATG4B and pmir-ATG4B-mut, respectively. pmir-ATG4B-mut contained mutations of the putative miR-543 binding site in 3′-UTR of ATG4B mRNA (1565 TGTCAG ACACAGACATGAAT TT CT 1588, the underlined nucleotides were mutated). The overexpression plasmid pCMV-ATG4B was bought from Lab Cell Biotechnology (Chongqing, China).
Pcdna3.1 pcdna3.1 expression vector
Manufactured by Thermo Fisher Scientific
Sourced in China, United States
The pcDNA3.1(+) (pcDNA3.1) expression vector is a plasmid designed for high-level expression of recombinant proteins in mammalian cell lines. It contains a cytomegalovirus (CMV) promoter, which drives the expression of the gene of interest, and a neomycin resistance gene for selection of transfected cells.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using pcdna3.1 pcdna3.1 expression vector
1
Plasmid Construction for CRNDE and ATG4B
2
Cloning and Mutation of CRNDE and ATG4B
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA fragments encoding the wild type and the mutant human CRNDE containing mutations of the predicted miR-543 binding site (1008 CTTTATTGGATTGAATGAATGTTT 1031, the underlined nucleotides were mutated) were chemically synthesized by Sangon Biotech (Shanghai, China), and separately inserted into pcDNA3.1(+) (pcDNA3.1) expression vector (Invitrogen, Carlsbad, CA, USA) after digestion with EcoR (Takara) and BamH (Takara). The reconstructed plasmids were named as pcDNA-CRNDE and pcDNA-CRNDE-mut, respectively. The DNA fragments encoding the wild type and the mutant 3 -UTR of human ATG4B mRNA containing mutations of the putative miR-543 binding site (1565 TGTCAGACACAGACATGAATTTCT 1588, the underlined nucleotides were mutated) were separately synthesized by Sangon Biotech, digested with Sac (Takara) and Sal (Takara), and then cloned into pmir-GLO reporter vector (Thermo Scienti c, Waltham, MA, USA). The reconstructed plasmids were named as pmir-ATG4B and pmir-ATG4B-mut, respectively. The overexpression plasmid pCMV-ATG4B was bought from Lab Cell Biotechnology (Chongqing, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!