Nanodrop 1000 3

Manufactured by Thermo Fisher Scientific

Sourced in United Kingdom

The Nanodrop® 1000 3.7.1 is a spectrophotometer designed for measuring the concentration and purity of nucleic acid and protein samples. It requires only a small sample volume to perform these measurements.

Automatically generated - may contain errors

Lab products found in correlation

7 protocols using nanodrop 1000 3

FFPE Colorectal Tumor DNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human FFPE DNA was extracted from between six and nine 5-micron FFPE colorectal tumour blocks using the QiaAmp Micro Kit (Qiagen, Qiagen Ltd, Manchester, UK). A marked up H&E stained section was used to guide macrodissection of tumour tissue. An assessment of DNA quality and quantity was made initially using a Nanodrop 1000 3.3.0 (Thermo Scientific, Paisley, UK), then the quantity of double stranded DNA was determined using the Quant-iT Picogreen ds DNA Assay Kit (Life technologies, Paisley, UK). Sample concentrations were checked and normalised to 20 ng (six samples) and 250 ng (six samples).
Genomic DNA was extracted from HNSCC fresh tissue biopsies using the DNeasy blood and tissue kit (Qiagen). Cell-free DNA was extracted from 2 mL of plasma from HNSCC blood samples using the QIAamp circulating nucleic acid kit (Qiagen). Sample concentrations were checked and normalised to 20 ng (six ctDNA samples) and 250 ng (six tissue samples).
For the blood samples, a Promega Maxwell RSC instrument (AS4500) was used with the Maxwell RSC Whole Blood DNA Kit (AS1520) (Promega, Southampton, UK). This is a semi-automated DNA extraction method that utilises paramagnetic particles in pre-loaded cartridges to bind DNA and elute into 20 µL volumes. The purified DNA was quantified using the Qubit 2.0 Fluorometric Quantitation instrument using the dsDNA BR (broad range) assay.

Whalley C., Payne K., Domingo E., Blake A., Richman S., Brooks J., Batis N., Spruce R., Mehanna H., Nankivell P, & Beggs A.D. (2021). Ultra-Low DNA Input into Whole Genome Methylation Assays and Detection of Oncogenic Methylation and Copy Number Variants in Circulating Tumour DNA. Epigenomes, 5(1), 6.

+ Open protocol

+ Expand

FFPE and Tissue Genomic DNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human FFPE DNA was extracted from between six and nine 5-micron FFPE colorectal tumour blocks using the QiaAmp Micro Kit (Qiagen, Qiagen Ltd, Manchester, UK). A marked up H&E stained section was used to guide macrodissection of tumour tissue. An assessment of DNA quality and quantity was made initially using a Nanodrop 1000 3.3.0 (Thermo Scientific, Paisley, UK), then the quantity of double stranded DNA was determined using the Quant-iT Picogreen ds DNA Assay Kit (Life technologies, Paisley, UK). Sample concentrations were checked and normalised to 20 ng (six samples) and 250 ng (six samples).
Genomic DNA was extracted from HNSCC fresh tissue biopsies using the DNeasy blood and tissue kit (Qiagen). Cell-free DNA was extracted from 2 mL of plasma from HNSCC blood samples using the QIAamp circulating nucleic acid kit (Qiagen). Sample concentrations were checked and normalised to 20 ng (six ctDNA samples) and 250 ng (six tissue samples).
For the blood samples, a Promega Maxwell RSC instrument (AS4500) was used with the Maxwell RSC Whole Blood DNA Kit (AS1520) (Promega, Southampton, UK). This is a semi-automated DNA extraction method that utilises paramagnetic particles in pre-loaded cartridges to bind DNA and elute into 20 μL volumes. The purified DNA was quantified using the Qubit 2.0 Fluorometric Quantitation instrument using the dsDNA BR (broad range) assay.

+ Open protocol

+ Expand

Bovine Ovary RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For our bovine study, the ovarian tissue samples previously frozen were homogenized in 1 mL TRIzol with 0.5 g ceramic beads in homogenization tubes using the Mo Bio PowerLyzer 24 (Mo Bio Laboratories Inc, Carlsbad, CA, USA). The cells previously harvested for RNA and the homogenized tissue samples underwent further treatment for RNA extraction as per manufacturer's instructions (Ambion/Life Technologies). Using a Nanodrop spectrophotometer (Nanodrop 1000 3.7.1, Thermo Fisher Scientific), the RNA concentrations were determined based on the 260 λ (wavelength) absorbance. All samples had a 260/280 λ absorbance ratio >1.8 indicating sufficient RNA purity for analysis. Two hundred nanograms of each DNAse-treated RNA underwent cDNA synthesis as described in a previous study (Matti et al. 2010) (link).
For the human samples, RNA was extracted from cells using the RNeasy Micro Kit (Qiagen) with on-column DNase I digestion as per manufacturer's instructions. After quantification on a Nanodrop spectrophotometer, reverse transcription was carried out using 200 ng RNA/reaction with the Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific).

Bastian N.A., Bayne R.A., Hummitzsch K., Hatzirodos N., Bonner W.M., Hartanti M.D., Irving-Rodgers H.F., Anderson R.A, & Rodgers R.J. (2016). Regulation of fibrillins and modulators of TGFβ in fetal bovine and human ovaries. Reproduction (Cambridge, England), 152(2).

+ Open protocol

+ Expand

Extraction and Quantification of Total RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA (1 µg) was extracted from adipocytes after 5 days of exposure to antiretroviral drug, CLA isomer or control using the RNeasy Mini Kit according to manufacturer's instructions (Qiagen, Manchester, UK). Briefly, cells were lysed and homogenised using a highly denaturing guanidine-thiocyanate-containing buffer. Ethanol was added to provide appropriate binding conditions and the sample was then applied to an RNeasy Mini spin column. Total RNA binds to the membrane and contaminants were efficiently washed away.
RNA was eluted in 50 μl nuclease-free water. RNA was quantified using the NanoDrop® 1000 3.7.1 (Thermo Scientific, Wilmington, USA). RNA integrity numbers can be found in Supplementary Table 1.

Loonam C.R., O'Dell S.D., Sharp P.A, & Mullen A. (2017). Conjugated Linoleic Acid Isomers Exert Differential Effects on an Adipocyte Model of HIV-associated Lipodystrophy. Current HIV research, 15(1).

+ Open protocol

+ Expand

DNA Extraction from Cell Pellets

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell pellets for DNA extraction were stored at − 20 °C. After thawing of the pellet, DNA was extracted using the QIAmp^® DNA Blood Midi Kit (Quiagen, Cat. No. 51185) following the manufacturer’s protocol. DNA content was measured by Nanodrop^® 1000 3.7.1 (Nanodrop Technologies).

Dimonte S., Bruske E.I., Enderes C., Otto T.D., Turner L., Kremsner P, & Frank M. (2020). Identification of a conserved var gene in different Plasmodium falciparum strains. Malaria Journal, 19, 194.

+ Open protocol

+ Expand

Fetal Ovary RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from the whole fetal ovary using 1 mL Trizol (Thermo Fisher Scientific) with 0.5 g of ceramic beads in homogenisation tubes using the Mo Bio Powerlyser 24 (Mo Bio Laboratories Inc.) and 200 mL chloroform (RNase-free) according to the manufacturer's instructions. The RNA concentration was determined using a Nanodrop spectrophotometer (NanoDrop 1000 3.7.1; Nanodrop Technologies) based on the 260l (wavelength) absorbance. All samples which had a 260 : 280l absorbance ratio .1.8 were used and subsequently treated with DNase I (Promega/Life Technologies Australia Pty Ltd). Complementary DNA was then synthesised from 200 ng of DNase-treated RNA using 250 ng mL À1 random hexamers (Geneworks) and 200 U Superscript Reverse Transcriptase III (Thermo Fisher Scientific) as previously described (Matti et al. 2010) (link). For a negative control, diethyl pyrocarbonate (DEPC)treated water instead of the Superscript Reverse Transcriptase III was added.

Hartanti M.D., Hummitzsch K., Irving-Rodgers H.F., Bonner W.M., Copping K.J., Anderson R.A., McMillen I.C., Perry V.E.A, & Rodgers R.J. (2019). Morphometric and gene expression analyses of stromal expansion during development of the bovine fetal ovary. Reproduction, fertility, and development, 31(3).

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis from Parasite Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols

20 ml parasite cultures were used for RNA extraction. The culture was pelleted, washed several times with 1× PBS and the erythrocytes were lysed with 0.02% saponin. The pellet was then washed 3 times with 1× PBS and resolved in 750 µl of Trizol^® LS Reagent (Invitrogen). The samples were stored at − 20 °C until further processing.
For RNA extraction, 0.2 ml chloroform were added to 750 µl of thawed Trizol-lysate, shaken vigorously for 15 s and left at room temperature for 10 min. A 15 min centrifugation step at 12,000g at room temperature followed for phase separation. RNA was extracted from the aqueous phase with the PureLink™ RNA Mini Kit (ambion by Life Technologies) according to the manufacturer’s protocol. RNA content was measured by Nanodrop^® 1000 3.7.1 (Nanodrop Technologies). All samples were treated with DNAse I^® (Invitrogen) according to the manufacturer´s protocol to remove any remaining DNA. cDNA was synthesized with random primers and Superscript II Reverse Transcriptase^® (Invitrogen) according to the manufacturer´s protocol. cDNA was tested for absence of DNA contamination by evaluation of proper splicing of the gene PFD1155w by PCR with the primer 5′GCAGGGAAAGGTTTTTCAAG3′ and the reverse primer 5′AAAGCTGAATCTTGGCCCGTT 3′ as described elsewhere [22 (link)].

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!