Ncoi and noti

Addgene plasmid #102919 (https://www.addgene.org/102919/) was used to express ABE7.10 for the in vitro experiments. For U6-sgRNA expression plasmids, five different gRNA oligonucleotides were synthesised (Sigma) and cloned into the pU6gRNA vector using the BsmBI restriction site (Supplementary Table 2). To generate the retroviral construct for the GFP switch-on system, gfp was PCR-amplified from pSERS11 SF GFP^{24 (link)} and modified by using a long primer containing Gly-Ser stretch, the stop codon TAG and the restriction site for NcoI (Sigma; P1 and P2 in Supplementary Table 1). The backbone and the PCR product were digested using NcoI and NotI (NEB) and ligated with T4 ligase (NEB).
Similarly, to generate the retroviral construct for the HFE-GFP switch-on system, gfp was PCR-amplified from pSERS11 SF GFP using a long primer containing 20 bp of the HFE sequence, carrying the stop codon TAG, a Gly-Ser stretch and the restriction site for NcoI (Sigma; P3 and P2 in Supplementary Table 1). The backbone and the PCR product were digested using NcoI and NotI (NEB) and ligated with T4 ligase (NEB). Amplification of plasmids was performed in One Shot™ Stbl3™ Chemically Competent E. coli (C737303, Invitrogen).

Mutants of the PNPase gene for in vitro studies were prepared by two successive PCR reactions. In the first step, two fragments were PCR-amplified using the wild-type PNPase gene as a template: one using the forward primer PNPaseNcoFor and a reverse primer introducing the mutation (primers PNPaseS1x2Rev or PNPaseKHx2Rev or PNPaseS1x4Rev) (Table S1); the other using a reverse primer PNPaseNotRev and a forward primer introducing the mutation (primers PNPaseS1x2For or PNPaseKHx2For or PNPaseS1x4For) (Table S1). PCR products were resolved on 1% low melting point agarose gel (Sigma), the bands of interest were excised and after melting the matrix at 70°C, they were mixed in one PCR reaction which amplified the entire PNPase gene, with mutations, using primers PNPaseNcoFor and PNPaseNotRev. The product of the last PCR was digested with NcoI and NotI (NEB), resolved on a low melting point agarose gel, and the gel band was directly ligated with T4 ligase (NEB) into a pET duet plasmid, which had been digested with the same restriction enzymes and dephosphorylated with CIP (NEB) according to the manufacturer’s instructions.

The starting material for library construction was the pHEN C1 phagemid previously described [16] (link). Plasmid DNA was submitted to random mutagenesis by epPCR using GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) according to the high mutation rate protocol using the C1 specific upstream primer 5′TTATTACTCGCGGCCCAGCCGG3′ that hybridized just upstream of the NcoI restriction site of the pHEN vector and downstream primer 5′ GTGATGGTGATGATGATGTGC 3′. The mutated gene fragments were gel purified and digested with NcoI and NotI (New England Biolabs) followed by ligation into the corresponding sites of the pHEN phagemid containing an irrelevant scFv in order to avoid the presence of the native scFvC1 in the subsequent steps of affinity maturation. The library was subsequently transformed into electro competent XL1 blue Escherichia coli (E.coli) (Stratagene) and random clones sequenced with the primers LMB3 5′ACAGGAAACAGCTATGACC3′ and pHEN-SEQ 5′CTATGCGGCCCCATTCAG3′.