Dna sequencing

The extracellular domain sequence (CDS) of CD2v/EP402R gene based on ASFV-SY18 isolates (GenBank accession MH766894) was retrieved from the National Center for Biotechnology Information (NCBI) Reference Sequence database. Next, specific primers were designed to introduce EcoRI and XhoI [New England Biolabs (NEB), United States] restriction sites Ligated with pCAGGS vector (TransGen Biotech, China), correct recombinant gene was confirmed by DNA sequencing [Sangon Biotech (Shanghai) Co., Ltd., China], and thus CD2v recombinant protein was correctly constructed. The transient transfection of CD2v recombinant DNA was performed with Lip2000 (Gibco, ThermoFisher Scientific, United States) in HEK293F cells. At 72-h post transfection, successful expressions were examined by western blot analysis using ASFV positive sera. To purify recombinant CD2v proteins, HEK293F cell supernatants were collected and then purified by HiPrep Q FF column (GE Healthcare, United States). Thereafter, the purified recombinant CD2v proteins were resuspended in 20 mM Tris–HCl and 150 mM NaCl The protein was verified by western blotting with ASFV-positive serum.

AmtR-His₆ expression plasmid constructed by PCR using the primers amtR-S/amtR-A was inserted into pET28a, which had a His₆-tag at its C-terminus. The plasmid was confirmed by DNA sequencing (Sangon Biotech, China). AmtR with a C-terminal His₆-tag was expressed in E. coli BL21, plasmid carrying cells were grown to an OD₆₀₀ of 0.6 at 37°C in LB medium, and protein production was induced using 0.5 mM IPTG at 16°C for 16 h. Cells were harvested by centrifugation and suspended in buffer A (100 mM Tris-HCl, 100 mM NaCl, pH 7.5), then supplemented with Mini protease inhibitor cocktail tablets (Roche, Germany). Cells disrupted by sonication at 4°C, and cell debris was removed by centrifugation at 4°C (15,000 g for 20 min). The AmtR-His₆ was purified by 5 ml nickel affinity chromatography using Ni-NTA agarose (Novagen, United States).

Genomic DNA from 786-O and Caki-1 cell line and two pairs of RCC and corresponding non-tumor tissues was bisulfite modified and the CpG islands amplified by PCR using the primers (forward) 5′- GTTAYGATGAGGTTATTAGGATAGAT -3′; (reverse) 5′- ATATCCTCCAAACTAAACCATTC -3′. The PCR products were separated by 3% agarose gel electrophoresis, extracted and then cloned into the pUC18 T-vector (Sangon, China). After bacterial amplification of the cloned PCR fragments by standard procedures, 8 clones were subjected to DNA sequencing (Sangon, China).

The tested genes were amplified from S. hygroscopicus OsiSh-2 DNA using Phanta Max Super-Fidelity DNA polymerase (Vazyme Biotech, Nanjing, China). All sequences of the above genes were cloned separately into the vector pCAMBIA-1300-FLAG. Then, the results were verified by DNA sequencing (Sangon Biotech, Shanghai, China). Subsequently, the recombinant plasmids were introduced into A. tumefaciens strain GV3101, and then A. tumefaciens-mediated transformation (agroinfiltration) was used to transiently express the 15 corresponding coding genes in tobacco leaves. The primers used for transient expression are listed in Table S3.

The recombinant plasmid was transformed into E. coli BL21(DE3) to express the protein. DNA sequencing (Sangon Biotech, Shanghai, China) confirmed that the target gene was inserted into the plasmid. The recombinant expression strain was inoculated into 5 ml LB medium with the appropriate concentration of kanamycin (37°C, 200 r/min, overnight). This seed solution was inoculated into 50 ml LB medium until the OD₆₀₀ reached 0.6–0.8. Then, 0.2 mM of isopropyl β-D-L-thiogalactopyranoside (IPTG) was added to induce expression at 25°C and 200 r/min. The bacterial cells were obtained by centrifugation at 8,000 r/min at 4°C for 10 min and were resuspended in 20 mM PBS (pH 7.0). The cells were ultrasonically destroyed in an ice bath for 20 min. The cell disruption solution was centrifuged at 8,000 r/min at 4°C for 20 min, and the crude protein solution was obtained as the supernatant. In addition, to increase the expression of CGTase, with all of the above conditions unchanged, the IPTG concentration, induction time, and induction temperature were optimized to acquire high-level strains.

A 25 µL HR volume contained 100 ng linear DNAs of pET20b-AdD, pET21a-AdD, or pET22b-AdD, 1 × CE II buffer, and 2 µL ExnaseII (U not shown in the user manual). HR carried out at 37 °C for 30 min and stopped at 0 °C for 5 min. HR products containing 30 ng linear plasmid DNAs transformed into 200 µL home-made competent cells E. coli BL21(DE₃) at 42 °C [3 ]. Transformant efficiency calculated as an average of triplicates for number of transformants per ng of linear plasmid DNAs used for transformation. Electrophoresis separated the HR products into different components, and each component quantified by Gel-Pro Analyzer 4.0 (Media Cybernetics, Bethesda, MD, USA). Correlation made between quantity of nc-plasmid DNAs and transformant efficiency (OriginLab 8, Northampton, MA, USA). We screened 10 transformants to find expectation-sized plasmids, insert-vector junctions of which were checked scarless or not by DNA sequencing (Sangon Biotech, Shanghai, China).