The ChIP-IT® Express Chromatin Immunoprecipitation Kits (53009; Active Motif, Carlsbad, CA, USA) were used to carry out ChIP assay according to the instruction. The number of cells used was about 1x107. 1% formaldehyde was used to cross-linked DNA and protein for 10 minutes at room temperature. Glycine was used for fixation reaction. After homogenizing the cells, the solution was sonicated to obtain DNA fragments. Subsequently, the solution was centrifugated and the supernatant was used for immunoprecipitation by Sp1 antibody. Finally, the eluted DNAs were used to detect the levels of interaction between Sp1 and TIMP1 promoter DNA sequences.The primer sequences were listed below: TIMP1 BS1 (−138 to −128bp), forward 5’-AGGCGGCTTTTGGAAGGAATAG-3’, reverse 5’-CCCACCATCAGTGCAGAAGC-3’; TIMP1 BS2 (−48 to −38bp), forward 5’-AGTAATGCATCCAGGAAGCC-3’, reverse 5’-GGGCCCTGCTTACCTCTGGT-3’; TIMP1 BS3 (+248 to +258bp), forward 5’-AGGCTGGAACTGCTTTCCCA-3’, reverse 5’-GAAGGAATTTGCGGGGGGAT-3’.
Chip it express chromatin immunoprecipitation kit
Manufactured by Active Motif
Sourced in United States
The ChIP-IT Express Chromatin Immunoprecipitation (ChIP) Kit is a laboratory tool designed for the isolation and analysis of protein-DNA complexes. It provides a streamlined workflow for performing chromatin immunoprecipitation experiments.
Automatically generated - may contain errors
Lab products found in correlation
Igg isotype control, by Cell Signaling Technology (2 mentions)
Ab2769, by Abcam (2 mentions)
Tead4, by SCBT (2 mentions)
C jun, by Cell Signaling Technology (2 mentions)
Stepone system, by Thermo Fisher Scientific (2 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (2 mentions)
Chromatin ip dna purification kit, by Active Motif (2 mentions)
Sensifast sybr lo rox kit, by Meridian Bioscience (1 mentions)
Ab7900 standard real time pcr system, by Thermo Fisher Scientific (1 mentions)
Taq dna polymerase, by Takara Bio (1 mentions)
Anti p53 do 1, by Santa Cruz Biotechnology (1 mentions)
Lightcycler instrument, by Roche (1 mentions)
Normal mouse igg, by Cell Signaling Technology (1 mentions)
Anti rela antibody, by Cell Signaling Technology (1 mentions)
Anti myc antibody, by Abcam (1 mentions)
Control igg, by Abcam (1 mentions)
Control rabbit igg, by Cell Signaling Technology (1 mentions)
Ab171870, by Abcam (1 mentions)
Dynabead, by Thermo Fisher Scientific (1 mentions)
Pcr purification kit, by Qiagen (1 mentions)
39 protocols using chip it express chromatin immunoprecipitation kit
1
ChIP-IT® Express for Sp1-TIMP1 Interaction
2
ChIP-IT® Express Chromatin Immunoprecipitation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For ChIP assays, we used ChIP-IT® Express Chromatin Immunoprecipitation Kits (Active Motif) according to the manufacturer’s instructions. Primers used for ChIP quantification are listed in Table S2.
3
ChIP-seq analysis of ATF1/CREB1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) was performed using ChIP-IT Express Chromatin Immunoprecipitation Kits (Active Motif). MDA-MB-231 cells were crosslinked with 1% formaldehyde for 15 min at RT and then quenched with 10 ml 200 mM Glycine. The cross-linked chromatin was sheared using Covaris S220 (Covaris) following the manufacturer’s manual. Pre-cleared DNA was then used for immunoprecipitation with 10 μl α-ATF1/CREB1 (Santa Cruz, Cat# sc-270, RRID: AB_2290030) antibody or control IgG and Protein G magnetic beads at 4 °C overnight. The immune complexes were washed, eluted and reverse cross-linked according to the manufacturer’s protocol. For ChIP-PCR, DNA was extracted by phenol and phenol/chloroform extractions. The primers for ChIP-PCR analysis were listed in Supplementary Table S4c .
4
AhR Binding to Glut4 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
KGN cells were plated at a density of 2 × 105 cells and cultured for 24 hours with each treatment condition. After collection of cells, ChIP-qPCR was performed by using ChIP-IT Express Chromatin Immunoprecipitation Kits (Active Motif, CA, USA) according to the manufacturer’s protocol. The antibodies used included anti-AhR (Abcam, Ab2769) and an IgG isotype control (Cell Signaling Technology, 3900). The Glut4 primer sequences were 5′-ATGACCTCTGGTCACCAAACTG-3′ (sense) and 5′-GATCAGTCAGAAGCATAGGTGAC-3′ (antisense). Real-time PCR amplification was carried out and amplification of target gene is shown as fold enrichment compared to that of irrelevant antibody controls. The results were from 3 independent experiments followed by normalization to input signals and showed as mean ± SEM.
5
NF-κB Binding Site Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was carried out by a ChIP‐IT® Express Chromatin Immunoprecipitation Kits (Active Motif, Carlsbad, CA, USA). Mouse primary RMICs were seeded in 15 cm plates at a density of 80%–90% confluence. Immunoprecipitation was performed with Anti‐ NF‐κB Antibody (CST) and normal mouse IgG as control at 4°C overnight. Precipitated DNA was analysed by PCR using the primers 5’‐GATCCCCAGTCACCCAACTC‐3′ (sense) and 5’‐TTCCCCTCCCTCCCCTAGA‐3′ (antisense). An amplified product with 219 bp (−1097 bp ~ −878 bp) was then examined by electrophoresis.
6
ChIP Assay for Foxc1/Foxc2 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the in vivo ChIP experiments, extracts were prepared from approximate 1 × 107 of P19CL6 cells49 (link) which were transfected by FLAG-tagged Foxc1 or Foxc2 expression vectors 48 hours before harvest. For the ChIP assays, the ChIP-IT Express Chromatin Immunoprecipitation Kits (Active Motif) were used according to manufacturer’s protocol. Primers in PCR reactions were 5′-ACAAGCTTCGCTGGACTGAT-3′ and 5′-TCTCGGCTCACTCTCTGGTT-3′ (−148 + 43). The amplified region corresponded to the mouse Sema3c promoter, which encompasses the FOX-binding site.
7
ChIP-IT Express Chromatin Immunoprecipitation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed using ChIP-IT Express Chromatin Immunoprecipitation Kits (Active Motif) according to the manufacturer’s protocol. See Supplemental Methods for details. Detailed information on the Critical Commercial Assays is provided Supplemental Table 3 , and the primers used are listed in Supplemental Table 6 .
8
ChIP-seq Analysis of Chromatin Modifications
9
ChIP-qPCR Analysis of p53 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assay was performed by using ChIP-IT Express Chromatin Immunoprecipitation Kits (Active Motif, Carlsbad, CA, USA) according to the manufacturer’s protocol. After cell fixation and chromatin shearing, 2 μg of anti-p53 (DO-1, 1: 1000, Santa Cruz) antibody or a monoclonal mouse IgG (Active Motif, Carlsbad, CA, USA) was mixed with chromatin solutions and incubated at 4°C overnight on an end-to-end rotator. Crosslinks were reversed, and protein was removed by digestion with proteinase K. Purified ChIP DNA or inputs were further detected by semi-quantitative PCR. Primers specific for putative p53-BS upstream of the pre-miR-492 were: forward: 5′-CGACATCAGCAGTCCCTA-3′, reverse: 5′-AGATACGTGCCGAGAAAG-3′. The PCR was conducted by using Taq DNA polymerase (TaKaRa, Japan) with a reaction condition as 36 cycles of 30 seconds at 95°C, 30 seconds at 52°C, and 1 minute at 72°C. The PCR products were separated by electrophoresis on 2% agarose gels and visualized under ultraviolet light.
10
Chromatin Immunoprecipitation: ChIP-IT® Express Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed with ChIP-IT® Express Chromatin Immunoprecipitation Kits (Active Motif) according to the manufacturer's protocol. In brief, cells were grown to 90% confluence in 150-mm dishes. After crosslinking, cells were lysed in ice-cold complete lysis buffer on ice for 30 min. Nuclei were pelleted at 2400 g for 10 minutes at 4°C, and were resuspended in complete shearing buffer. Chromatin was sheared into 100 bp to 1000 bp fragments by sonication. Ten micrograms of total chromatin was incubated overnight at 4°C with 1 μg antibody. After washing, the immune complex was eluted by adding 100 μl of elution buffer. Subsequently, 2 μl of 5 M NaCl is added to reverse the formaldehyde cross-linking at 65°C for 1.5 h. Following incubation with proteinase K, DNA was obtained and analyzes by real-time PCR. The PCR is performed in a final volume of 10 μl using a LightCycler instrument (Roche Diagnostics) according to the manufacturer’s recommendations. Real-time PCR was performed with the following prime/probe pairs:
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!