The largest database of trusted experimental protocols

Lipofectamine 3000 transfection kit

Manufactured by Thermo Fisher Scientific
Sourced in United States, China

Lipofectamine 3000 is a transfection reagent developed by Thermo Fisher Scientific for the efficient delivery of DNA, RNA, and other molecules into a variety of cell types. It provides high transfection efficiency and low cytotoxicity, making it suitable for a range of applications in cell biology research.

Automatically generated - may contain errors

292 protocols using lipofectamine 3000 transfection kit

1

Inhibition of pRb and 4E-BP1 Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies against pRb (9309), phospho-4E-BP1S65 (9451), 4E-BP1 (9452), cleaved poly-ADP-ribose polymerase (PARP) (9541), GAPDH (2118) and Actin (3700) were obtained from Cell Signaling Technology; anti-mouse (SA00001-1) and anti-rabbit (SA00001-2) HRP-conjugated secondary antibodies were obtained from Proteintech. Negative control scrambled siRNA (D-001206) and siRNA targeted against human pRb (L-003296-02-0005) were obtained from Dharmacon. Plasmid with hemagglutinin (HA) tagged pRb and HA tagged empty vector were obtained from Genewiz. Lipofectamine RNAiMax (13778) used for siRNA transfection and Lipofectamine 3000 transfection kit (L3000015) used for plasmid transfection, and XTT (X6493) were obtained from ThermoFisher. Rapamycin (R-5000) was obtained from LC Laboratories. The E2F inhibitor HLM006474 (324461) was obtained from Sigma.
+ Open protocol
+ Expand
2

GLUT4 Translocation Assay in C2C12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The GLUT4 translocation assay was adapted from a published protocol [37 (link)]. The pEGFP-myc-GLUT4-mCherry recombinant construct for GLUT4 fusion protein was generated using the pLenti-myc-GLUT4-mCherry plasmid [37 (link)] (Addgene plasmid #64049). C2C12 cells were transfected with the recombinant plasmid using a Lipofectamine 3000 Transfection Kit (Thermo Scientific, USA). Stably transfected cells were selected and grown for further assays. C2C12 cells expressing the GLUT4 fusion protein were grown on coverslips in serum-free DMEM medium and treated with 20 μM aM1 for 24 h. The positive control group was treated with 100 nM insulin for 30 min, and the mock control was treated with PBS. After treatment, the culture medium was aspirated, and the cells were washed three times with PBS. Nonpermeabilized cells were immediately fixed with 10% formalin for 30 min, washed, and blocked with 1% BSA for 1 h at RT. After blocking, the cells were incubated with Alexa Fluor 488-conjugated c-Myc antibodies overnight at 4 °C. Subsequently, coverslips were retrieved, mounted onto slides, and visualized using a Nikon ECLIPSE Ti-S inverted microscope.
+ Open protocol
+ Expand
3

Lipofectamine 3000 Transfection of A549 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transfected using Lipofectamine 3000 transfection kit (L3000015 Thermo Fisher, Waltham, MA, USA) as per manufactures instructions with the following modification: 2.5 µg of plasmid per plate, optional p3000 reagent was utilized, transfections were incubated for 4 h. Human A549 adenocarcinoma alveolar basal epithelial cells were cultured as suggested by the ATCC. Cells were plated at 4 × 105 cells/dish 24 h prior to transfection. Immediately prior to transfection cells were washed with 1 mL of PBS, and media replaced with 1 mL Opti-MEM (31985070 Thermo Fisher, Waltham, MA, USA). After 4 h, transfection media was aspirated and replaced with 2 mL Opti-MEM.
+ Open protocol
+ Expand
4

Regulation of Luciferase Reporter in A549 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A549, A549-PR-B or A549-PR-BΔSH3 cells were seeded at 3×104 cells/well in RPMI supplemented with 5% FBS and 1% PenStrep in a 24-well plate and incubated overnight. The following day, medium was removed and cells were rinsed twice with PBS before medium was replaced with RPMI supplemented with 5% DCC-FBS (Dextran-coated charcoal stripped FBS; Gibco/Life Technologies, Gaithersburg, USA). Cells were transfected with 50 ng pRL-CMV (Renilla) and 450 ng PRETK-Luciferase reporter construct [35 (link)]. Transient transfections were carried out using the Lipofectamine® 3000 transfection kit (Thermo-Fisher Scientific, Waltham, USA). At twenty-four hours after transfection, cells were treated with 500 ng/ml Dox and 10 nM R5020 or ethanol (vehicle control) for an additional 24 hours. Cells were then harvested, and lysates were analyzed for luciferase activity using the Dual-Glo® Luciferase Assay System (Promega, Madison, USA) according to the manufacturer’s recommendation.
+ Open protocol
+ Expand
5

Recombinant Antibody Production in HEK 293T

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lipofectamine 3000 Transfection Kit (Thermo Fisher Scientific) was used to transfect adherent HEK 293T cells (ATCC CRL11268) with dAMb 2–12C plasmids. Medium was harvested 72 h posttransfection and filtered using 0.22-μm Stericup-GP Vacuum Filtration System (Millipore, Burlington, MA). The supernatant from pDNA-transfected cells was purified using Protein G GraviTrap (GE Healthcare, Chicago, IL) according to the manufacturer’s instructions. The eluted protein was concentrated by Amicon Ultra-15 Centrifugal Filter Unit (30 kDa) and quantified by nanodrop.
+ Open protocol
+ Expand
6

Immunofluorescence Assay for S1 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
HeLa cells were seeded onto a coverslip in a 24-well plate (1 × 105 cells per coverslip) and incubated at 37 °C in a humidified, 5% CO2 incubator overnight. Cells were transfected with recombinant S1-pTriEx1.1 plasmids using a Lipofectamine™ 3000 transfection kit (Thermo Fisher Scientific) and incubated for 2 days to allow expression of the 8× His tagged-S1 protein. Thereafter, the cells were fixed with ice-cold 1:1 acetone-methanol for 10 min, rinsed with PBS and blocked with 5% FBS in PBS. Next, 10 µg of purified mAbs and rabbit anti-His antibody was added, and the samples were kept at room temperature for 1 h. After washing with PBS, goat anti-mouse IgG (H + L)-Alexa Fluor® 488 (Thermo Fisher Scientific), goat anti-mouse IgM-Alexa Fluor® 488 (BioLegend, San Diego, CA, USA), and donkey anti-rabbit IgG (H + L)-Alexa Fluor® 555 (Invitrogen, Waltham, MA, USA) were applied as secondary antibodies. DAPI (Thermo Fisher Scientific) was used for locating nuclei. PBS served as a negative binding control.
+ Open protocol
+ Expand
7

Modulating Protein Expression in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To knock down expression, we used predesigned sets of 4 independent siRNA sequences of the target genes (siGENOME SMARTpool, Dharmacon, and Thermo Scientific, Pittsburgh, PA). To achieve overexpression of Chk1 and TAZ, we used pcDNA4-Chk1-Flag for Chk1 and pCMV5-TOPO-3Xflag-TAZ for TAZ (Addgene). Controls included cells that were mock transfected (no siRNA or DNA), those transfected with vector alone (for overexpression experiments), and those transfected with a nontargeting (scrambled) siRNA (for knockdown experiments). Cells were harvested, washed, and suspended (2 × 106/100 μL) in Nucleofector V solution (Lonza Group, Walkersville, MD). siRNA (200 pmol/100 μL), DNA (3 μg/100 μL), or controls were added and electroporated using the U031 or U024 Nucleofector program (Lonza) as described previously [46 (link)]. WTBRAF overexpression was performed by Lipofectamine 3000 Transfection Kit (ThermoFisher Scientific, Grand Island, NY) according to the manufacturer's instruction. Overexpression or knockdown was confirmed using Western blot analysis as described above.
+ Open protocol
+ Expand
8

GLUT4 Translocation Assay in C2C12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The GLUT4 translocation assay was adapted from a published protocol [37 (link)]. The pEGFP-myc-GLUT4-mCherry recombinant construct for GLUT4 fusion protein was generated using the pLenti-myc-GLUT4-mCherry plasmid [37 (link)] (Addgene plasmid #64049). C2C12 cells were transfected with the recombinant plasmid using a Lipofectamine 3000 Transfection Kit (Thermo Scientific, USA). Stably transfected cells were selected and grown for further assays. C2C12 cells expressing the GLUT4 fusion protein were grown on coverslips in serum-free DMEM medium and treated with 20 μM aM1 for 24 h. The positive control group was treated with 100 nM insulin for 30 min, and the mock control was treated with PBS. After treatment, the culture medium was aspirated, and the cells were washed three times with PBS. Nonpermeabilized cells were immediately fixed with 10% formalin for 30 min, washed, and blocked with 1% BSA for 1 h at RT. After blocking, the cells were incubated with Alexa Fluor 488-conjugated c-Myc antibodies overnight at 4 °C. Subsequently, coverslips were retrieved, mounted onto slides, and visualized using a Nikon ECLIPSE Ti-S inverted microscope.
+ Open protocol
+ Expand
9

Stable Luciferase-Expressing HCC1954 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stable luciferase-expressing HCC1954 cells (HCC1954-luc) were generated by transfection with the firefly luciferase gene (luc2) encoding plasmid pGL4.51[luc2/CMV/Neo] (Promega) using the Lipofectamine 3000 Transfection Kit (Thermo Fisher Scientific). For the selection of transfected cells, 200 µg/ml geneticin disulfate (G418) (Carl Roth) was used.
+ Open protocol
+ Expand
10

Silencing LINC01559 and Vimentin

Check if the same lab product or an alternative is used in the 5 most similar protocols
SiRNAs were obtained from Ribobio (Guangzhou, China) and transfected using the lipofectamine 3000 Transfection Kit (ThermoFisher Scientific, #L3000-015). ShRNA oligos were purchased from TSINGKE Biological Technology (Beijing, China). The siRNA sequences directed against LINC01559 were GTAGGTGACTACAGTTAAT (LINC01559 siRNA1) and GCAAGAAGCTGGAAATCGA (LINC01559 siRNA2). The siRNA sequences directed against vimentin were GCAGAAGAATGGTACAAAT (Vimentin siRNA1) and CAACGAAACTTCTCAGCAT (Vimentin siRNA2). The shRNA sequence targeting LINC01559 was GATTATTTATTGTCTACTTAT (LINC01559 shRNA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!