Following cell sorting, cells were pelleted at 400g for 5 min, resuspended in PBS with 0.01% BSA, and counted with a hemocytometer. Cells were adjusted to a final concentration of 140,000 cells/ml. Drop-seq was then carried out at the Princess Margaret Genomics Facility (Toronto, ON) as described previously (52 (link)), except that flow rates of 3000 (cells and beads) and 13,000 μl/hour (oil) were used, and beads were resuspended at 167,000 per ml. Following Drop-seq droplet collection, complementary DNA amplification and sequencing library preparation were performed as described (52 (link)), and the libraries were sequenced on a high-output Illumina NextSeq 500 flow cell at the Princess Margaret Genomics Centre (Toronto, ON).
Nextseq 500 flow cell
Manufactured by Illumina
Sourced in United States
The NextSeq 500 flow cell is a critical component of the NextSeq 500 sequencing system. It is designed to hold and process DNA samples during the sequencing process. The flow cell provides a surface for the DNA samples to be loaded and sequenced, enabling the system to generate high-quality sequencing data.
Automatically generated - may contain errors
Lab products found in correlation
Quantseq 3 mrna seq library prep kit, by Lexogen (4 mentions)
High sensitivity dna chip, by Agilent Technologies (3 mentions)
Sequencing library qpcr quantification kit, by Illumina (3 mentions)
S2 focused ultrasonicator, by Covaris (3 mentions)
Quant it ribogreen rna assay, by Thermo Fisher Scientific (2 mentions)
Truseq dna pcr free ht library preparation kit, by Illumina (2 mentions)
Truseq small rna sample preparation kit, by Illumina (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Dna clean concentrator 25 column, by Zymo Research (1 mentions)
Ampure xp pcr purification system, by Beckman Coulter (1 mentions)
Truseq stranded total rna library preparation protocol, by Illumina (1 mentions)
Sequencing library qpcr quantification protocol guide, by Illumina (1 mentions)
Rna 6000 pico chip, by Agilent Technologies (1 mentions)
Ribo zero rrna removal kit for gram negative bacteria, by Illumina (1 mentions)
Dna 1000 chip, by Agilent Technologies (1 mentions)
Clc genomics workbench version 8, by Qiagen (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Rna 6000 nano chip, by Agilent Technologies (1 mentions)
Nextseq 500 550 high output v2.5 kit, by Illumina (1 mentions)
Qiaseq mirna library kit, by Qiagen (1 mentions)
14 protocols using nextseq 500 flow cell
1
Single-Cell RNA Sequencing Using Drop-seq
2
Illumina sRNA Library Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
sRNA libraries were prepared using Illumina’s TruSeq small RNA sample preparation kit (Illumina, San Diego, CA) according to the manufacturer’s recommendations. Briefly, RNA 3′ and RNA 5′ adapters were sequentially ligated unto 1 μg of high-quality purified sRNA sample using truncated T4 RNA Ligase 2 and T4 RNA Ligase, respectively. The sRNA fragments were then reverse-transcribed to generate first strand cDNA using SuperScript II reverse transcriptase (Catalog No. 18064014, ThermoFisher Scientific). The cDNA was converted into double-stranded cDNA with PCR using two primers that respectively anneal to the ends of 3′ and 5′ adapters. This process selectively enriches those fragments that have adapter molecules on both ends. The amplified cDNA was then purified on a 6% PAGE gel, normalized to 2 nM concentration, denatured with sodium hydroxide, and diluted in HT1 hybridization buffer (Catalog No. FC-404-2005, Illumina) for loading onto a NextSeq 500 flow cell. Sequencing reactions were carried out according to Illumina’s recommended protocol.
3
High-throughput Illumina Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 12.5 μl reverse transcription reaction above was added to a tube containing: 30 pmol of Illumina Truseq Universal PCR primer (5′-AATGAT ACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA); 30 pmol of Illumina Truseq Barcoded PCR primer (5′-CAAGCAGAAG ACGGCATACGAGATXXXXXXGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA, in which XXXXXX corresponds to standard Illumina Truseq barcodes); and 25 μl of 2x KAPA HiFi HotStart ReadyMix PCR Kit in a total volume of 50 μl. The reaction was heated to 98°C for 1 min, and then cycled 12 times with 98°C for 10 s, 60°C for 30 s, and 72°C for 15 s, followed by a single incubation at 72°C for 5 min. The resulting PCR products were isolated using AMPure XP PCR purification system (Agencourt, Beckman-Coulter), separated on a 4% Agarose gel, with PCR products cut in the 140–195 bps range, which corresponds to insert size of 20–75 bps. Library was extracted from the gel using Zymo agarose dissolve buffer (ADB) as specified by the Zymo manual and then run over a Zymo DNA Clean & Concentrator-25 column to purify. The prepared library was then loaded onto an Illumina NextSeq500 flowcell, sequenced for 75 bases of the insert and 7 bases of the index read using standard NextSeq500 sequencing reagents. Reads were then processed using CASAVA 1.8 and demultiplexed based on index sequences.
4
RNA-seq analysis of B. cenocepacia transcriptome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For each condition, three biological replicates were sequenced. RNA concentrations were measured with the Quant-iT RiboGreen RNA assay (Life Technologies, Inc.), and RNA quality was assessed by capillary electrophoresis with the RNA 6000 Pico Chip (Agilent Technologies). A 2-µg sample of RNA was depleted of rRNA with the Ribo-Zero rRNA Removal kit for Gram-negative bacteria (Illumina). Library preparation was performed in accordance with the TruSeq Stranded Total RNA Library Preparation protocol (Illumina). Libraries were quantified by qPCR in accordance with the Illumina Sequencing Library qPCR Quantification protocol guide, version February 2011. Library size distribution and quality were checked on a DNA 1000 chip (Agilent Technologies). Sequencing was performed with a high-throughput Illumina NextSeq 500 flow cell generating 75-bp single reads.
Reads were mapped to the B. cenocepacia LMG 16656 reference genome (6 (link)) with a 95% similarity cutoff by using CLC Genomics Workbench version 8.5.1 (Qiagen). Statistical analyses were performed with EDGE (Estimated Degree of Gene Expression). Genes were reported as significantly differentially expressed when the P value was <0.05 and there was a change of ≥1.5-fold.
Reads were mapped to the B. cenocepacia LMG 16656 reference genome (6 (link)) with a 95% similarity cutoff by using CLC Genomics Workbench version 8.5.1 (Qiagen). Statistical analyses were performed with EDGE (Estimated Degree of Gene Expression). Genes were reported as significantly differentially expressed when the P value was <0.05 and there was a change of ≥1.5-fold.
5
RNA-Seq Library Preparation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the Qiagen RNEasy kit following the manufacturer’s instructions including DNAse digestion. After RNA extraction, the concentration and quality of the total extracted RNA was checked by using the ‘Quant-it ribogreen RNA assay’ (Life Technologies, Grand Island, NY, USA) and the RNA 6000 nano chip (Agilent Technologies, Santa Clara, CA, USA), respectively. Subsequently, 250 ng of RNA was used to perform an Illumina sequencing library preparation using the QuantSeq 3′ mRNA-Seq Library Prep Kits (Lexogen, Vienna, Austria) according to manufacturer’s protocol. During library preparation 14 PCR cycles were used. Libraries were quantified by qPCR, according to Illumina’s protocol ‘Sequencing Library qPCR Quantification protocol guide’, version February 2011. A high sensitivity DNA chip (Agilent Technologies, Santa Clara, CA, US) was used to control the library’s size distribution and quality. Sequencing was performed on a high throughput Illumina NextSeq500 flow cell generating 75 bp single reads.
6
Microvesicle RNA Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from the EV cohort and the negative control (RNA extraction from culture medium) were subjected to library preparation. MicroRNA libraries were created with the QIAseq miRNA library kit (QIAGEN, Hilden, Germany). This kit was chosen over the Illumina library preparation kit, as its input requirement was lower and could accommodate the low RNA yields from erythrocyte‐derived EVs. Libraries were pooled and sequenced in single‐end fashion on a NextSeq 500 flow cell (NextSeq 500/550 High Output v2.5 kit , 150 cycles; Illumina, San Diego CA, USA).
7
Whole Genome Amplification Library Prep
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fragmentation of all WGA products to a mean size distribution of 350 bp was performed using the S2 Focused Ultrasonicator with Adaptive Focused Acoustics (AFA) technology (Covaris, Woburn, USA), according to manufacturer’s instructions. Resuspension buffer (provided in the TruSeq DNA PCR-free kit) was used to dilute all samples to a volume of 52.5 µL with a DNA input between 350 ng and 1 µg. Subsequently, library preparation, library quantification and single-end indexed 75 bp sequencing was performed as earlier clarified by Deleye et al.11 , respectively using the TruSeq DNA PCR-free HT library preparation kit (Illumina, San Diego, USA), the Sequencing Library qPCR Quantification kit (Illumina, San Diego, USA) and a high-output NextSeq. 500 flow-cell (Illumina, San Diego, USA).
8
RNA-seq Library Preparation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA-seq library preparation was performed using QuantSeq 3′ mRNA-Seq Library Prep Kits (Lexogen) following Illumina protocols. Sequencing was performed on a high-throughput Illumina NextSeq 500 flow cell. On average, 13.9 × 106 ± 7.1 × 106 paired-end reads per sample were uniquely mapped, with an average coverage per base of 101 paired reads. Details on the bioinformatic processing can be found in the supplemental information .
9
Illumina Sequencing Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA (150 ng) was used to perform an Illumina sequencing library preparation using the QuantSeq 3′ mRNA-Seq Library Prep Kits (Lexogen) according to manufacturer's protocol. During library preparation 17 PCR cycles were used. Libraries were quantified by qPCR, according to Illumina's protocol “Sequencing Library qPCR Quantification protocol guide,” version February 2011. A high-sensitivity DNA chip (Agilent Technologies) was used to control the library's size distribution and quality. Sequencing was performed on a high-throughput Illumina NextSeq 500 flow cell generating 75 bp single reads. Details on the bioinformatics processing can be found in the Supplemental Information .
10
Single-Cell Whole Genome Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WGA material was first fragmented to an average size of 200 bp using the S2 Focused Ultrasonicator (Covaris, Woburn, USA) following the manufacturer’s instructions (Duty cycle of 10%, Intensity of 5, 200 cycles per burst and Duration 120 sec). 8 ng of WGA product was used as input for fragmentation. Library preparation was performed using the NEBnext Ultra II Kit (New England BioLabs) according to manufacturer’s protocol using the entirety of the amplified material from the C1. Samples were then run through a BioAnalyzer high sensitivity chip (Agilent Technologies, Santa Clara, CA, USA) to control the library’s size distribution and quality. Library quantification was performed using a Sequencing Library qPCR Quantification Kit (Illumina, San Diego, USA). The libraries from the different samples were pooled equimolarly, denatured and diluted to a final loading concentration of 2.5 pM for sequencing. Sequencing was performed on a high throughput Illumina NextSeq. 500 flow cell (Illumina, California, USA) generating 75 bp single reads. Per sample, on average 3.92 ± 1.33 × 106 reads were generated.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!