Total RNA was isolated using TRIzol®Plus RNA Purification Kit (Invitrogen) and RNase-Free DNase Set (Qiagen) followed by reverse transcription using the SuperScript™ III First-Strand Synthesis SuperMix (Invitrogen) strictly according to the manufacturer’s instructions. Real-time qPCR was performed in triplicate on an ABI Prism 7700 Sequence Detector system (Applied Biosystems, Foster City, CA, USA) using an annealing temperature of 63°C and gene-specific primers listed in Table 1 . The data were normalized to GAPDH or 18S rRNA and calculated by 2−ΔΔCT method (27 (link)).
Abi prism 7700 sequence detector system
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The ABI Prism 7700 Sequence Detector System is a real-time PCR instrument designed for quantitative analysis of nucleic acid samples. The system utilizes fluorescence detection technology to monitor the amplification of target sequences during the PCR process. It provides precise quantification of DNA or RNA targets in a wide range of sample types.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (9 mentions)
Iscript cdna synthesis kit, by Bio-Rad (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Superscript first strand synthesis system, by Thermo Fisher Scientific (3 mentions)
Rneasy plant mini kit, by Qiagen (3 mentions)
Dnase 1, by Qiagen (3 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Quantitative sybr green pcr mix, by Bio-Rad (2 mentions)
Iscript reverse transcription supermix, by Bio-Rad (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Trizol plus rna purification kit, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis supermix, by Thermo Fisher Scientific (1 mentions)
Rnase free dnase set, by Qiagen (1 mentions)
Rneasy column, by Qiagen (1 mentions)
Trizol protocol, by Thermo Fisher Scientific (1 mentions)
Sds version 2, by Thermo Fisher Scientific (1 mentions)
Primer express software, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
27 protocols using abi prism 7700 sequence detector system
1
RNA Isolation and Real-time qPCR Analysis
2
Quantitative Real-Time PCR for mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression levels were determined by quantitative real-time PCR (qRT-PCR) as previously described.22 (link) Total RNA was isolated from lung tissue with Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), and complementary DNA was synthesized from RNA using a PrimeScript Reverse Transcriptase kit according to the manufacturer’s protocols. Quantitative real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) according to the protocols provided by the manufacturer with an ABI prism 7700 Sequence Detector System (Applied Biosystems). Murine primers used in this study are listed in Supplementary Table 1 . Target gene mRNA expression levels were calculated using the ΔCt method and normalized to glyceraldehyde 3-phosphate dehydrogenase mRNA expression.
3
Quantitative RT-PCR Analysis of Myelin Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Analyses were conducted with RNA extracts from spinal cord tissue of mutant mice and their littermate controls. Total RNA was extracted per the Trizol (Life Technologies) protocol. cDNA was generated with iScript™ cDNA Synthesis Kit (Bio-Rad). qRT-PCR was performed using the ABI Prism 7700 Sequence Detector System (Perkin-Elmer Applied Biosystems). qRT-PCR primers for mouse gene sequences were: Plp-f, tgctcggctgtacctgtgtacatt, Plp-r, tacattctggcatcagcgcagaga; mouse Mbp-f, tcacagaagagaccctcaca; Mbp-r, gccgtagtgggtagttcttg; Cnp1-f, tccacgagtgcaagacgctattca, Cnp1-r, tgtaagcatcagcggacaccatct; Chd7-f, gcctctcatcacgtacagca, Chd7-r, ggatgggggatttgtcctac; Elovl1-f, gaaagggctggacacttactt, Elovl1-r, cctcttcagtgtgaggagaaag; Creb3l2-f, aagaatacatggacagcctgg; Creb3l2-r, ttccccatcaccaaagtctg; Sorbs3-f, agatacactggactccgtacc; Sorbs3-r, caaatttctgagttcgccgg; Creb3l2-f, catcaccagcacctctcatc; Creb3l2-r, ccatttctcactctccacctc; Gapdh-f, tgccaaatatgatgacatcaagaa, Gapdh-r, ggagtgggtgtcgctgttg.
4
Quantitative Analysis of Cell Cycle Regulators
5
Quantitative RT-PCR Analysis of Myelin Gene Expression
6
Gene Expression Analysis of Embryonic Mouse Cortex
7
Quantitative PCR Analysis of hADSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
hADSCs were cultured for 7 days in CGM, OIM, and AIM with or without 10 nM PMA. Total RNA was collected using the initial steps of the TRIzol protocol (Invitrogen). After collecting the aqueous supernatant, the RNeasy column coupled with DNase set-based (Qiagen) protocol was followed. Reverse transcription was performed using 2 µg total RNA, 25 µg/mL oligo (dT)12-18 primers, and 200 units of SuperScript II reverse transcriptase (Invitrogen). For real-time PCR, 5 ng cDNA was amplified using SYBR Green PCR Master Mix (Applied Biosystems) and 0.33 µM each of forward and reverse primers on the ABI PRISM 7700 sequence detector system (Applied Biosystems). Primers for quantitative PCR were designed using the Primer Express software (Applied Biosystems) and synthesized at Cosmo Biotec (Korea). Analysis was performed using software (SDS version 2.1; Applied Biosystems) according to the manufacturer's instructions. Samples were normalized using the housekeeping gene GAPDH. Primers used for real-time PCR amplification are listed in Table 1 . All samples were tested in triplicate, and mean values were used for quantification.
8
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured cells (approximately 1-2 × 106 cells) using the TRIzol reagent (Roche Diagnostics). For quantitative RT-PCR, cDNA was synthesized from 1 μg of total RNA using random hexamers and M-MLV-reverse transcriptase (Invitrogen) and subjected to real-time PCR with specific TaqMan probes (Assays-on-demand TKTL1: Hs00202061_m1; ACLY: Hs00153764_m1; reference probe, PPIA: Hs99999904_m1) (Applied Biosystems, Foster City, CA) on a ABI Prism 7700 Sequence Detector System (Applied Biosystems). All reactions were performed in triplicate. Fold changes in gene expression were calculated using the ΔΔCt method, using as PPIA as a reference.
9
HTLV-1 Proviral Load Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from 106 cells using proteinase K and salting-out method. The HTLV-1 proviral load was quantified using a real-time TaqMan PCR method [39] (link). Albumin DNA was used as an endogenous reference. Amplification and data acquisition were carried out using the ABI Prism 7700 Sequence detector system (Applied Biosystems). Standard curves were generated using a 10-fold serial dilution of a double-stranded plasmid (pcHTLV-ALB). All standard dilutions and control and individual samples were run in duplicate for both HTLV-1 and albumin DNA quantification. The normalized value of the HTLV-1 proviral load was calculated as the ratio of (HTLV-1 DNA average copy number/albumin DNA average copy number) ×2×106 and expressed as the number of HTLV-1 copies/106 cells.
10
Quantifying TMBIM6 Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify the relative expression of TMBIM6 after treatment with different chemical compounds, we performed real-time PCR. The mRNA expression levels were determined by qRT-PCR as previously described [87 (link)]. Total RNA was isolated from cells with TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), and complementary DNA was synthesized from RNA using a PrimeScript Reverse Transcriptase kit (TaKaRa, Shiga, Japan) according to the manufacturer’s protocol. Quantitative real-time PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) according to the protocols provided by the manufacturer and using an ABI prism 7700 Sequence Detector System (Applied Biosystems). The real-time PCR program consisted of an initial denaturation at 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s; 60 °C for 20 s. The human TMBIM6 primers used in this study are listed in Table 1 . Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA expression was used as an endogenous control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!