Step one rt pcr system

In order to verify the transcriptome data, expression level of a randomly selected set of differentially regulated genes was measured by qRT-PCR. The total RNA was extracted from 10 fruits of each treatment by RNAiso Plus (TaKaRa, Japan) and then was pooled at equal quantity. After that, the RNA of three treatments (ABA, NDGA and CK) was reverse-transcribed to cDNA with RNA PCR kit (TaKaRa, Japan), respectively. qRT-PCR was performed with SYBR Premix Ex Taq (TaKaRa, Dalian, China) on ABI Step One RT-PCR system according to the manufacturer’s instructions. Three biological replicates were performed and the primer names and corresponding sequences were listed in S18 Table. Relative expression was normalized to the internal control gene β-actin gene with 2^-ΔΔCT method [40 (link)]. The untreated sample (CK) was set as the calibrator for relative expression level. Pearson’s correlation was performed to determine the correlation of genes expression in ABA and NDGA treatments relative to the control between qRT—PCR and sequencing.

An RNA miniprep kit was used to isolate total RNA from cells, and the concentration and purity were determined by a nucleic acid and protein detector (Nanodrop, Thermo). Then reverse transcription was performed with an RT kit to obtain the corresponding cDNA. The qRT-PCR was performed with cDNA (1:20, v:v) on an Applied Biosystems Step One RT-PCR system by using the TB Green kit (Takara, Japan). Table 1 shows the primer sequences of target genes.Table 1

Primer sequences for the qRT-PCR assay.

Name	Forward primer (5’-3’)	Reverse primer (5’-3’)
PTP1B	GCAGATCGACAAGTCCGGG	GCCACTCTACATGGGAAGTCC
GAPDH	GGTGAAGGTCGGAGTCAACG	CAAAGTTGTCATGGATGHACC

The primer sequences of PTP1B and GAPDH for the qRT-PCR assay.

The expression levels of a set of randomly selected 13 DEGs were validated by a qRT-PCR assay. Total RNA used for RNA-seq was treated with RNase-free DNase I (New England Biolabs, Ipswich, MA, USA) to eradicate all contaminating DNA. A total of 1,000 ng RNA was used for the reverse transcription with PrimeScript™1st stand cDNA Synthesis Kit. qRT-PCR was performed with SYBR Premix Ex Taq (TaKaRa, Dalian, China) on ABI Step One RT-PCR system, according to the manufacturer’s instructions (20 µL reaction mix: 1 µL cDNA, 10 μL 2 ×SYBR real-time PCR premixture, 0.4 µL each 10 µM primer, and 8.2 µL distilled water). Three biological replicates with two technical replicates were performed for each sample. The gene IDs and sequences of 13 primers are listed in Table 1. The PCR program was as follows: 95 °C for 5 min, followed by 40 cycles of 95 °C for 15s, and 60 °C for 30s. Relative expression was normalized to the internal control gene GAPDH gene with 2^−ΔΔCT method (Livak & Schmittgen, 2001 (link)). Pearson’s correlation was performed using R software (ver. 3.2.4, R Core Team, 2014 ) to determine the correlation of gene expression between qRT-PCR and transcriptomic data.

The qRT-PCR was used not only to measure the transcriptional abundance of genes involved in hormone biosynthesis and signaling across the time course, but also to verify the expression patterns of the 9^th day fruits revealed by the RNA-seq analysis. For each treatment at a specific time point, the total RNA was extracted from 10 randomly selected fruits and was subsequently blended at equal quantity. Then, the three pools of RNA (ABA, NDGA and CK), one representing each treatment at a specific time point, were reverse-transcribed to cDNA with RNA PCR kit (TaKaRa, Japan), respectively. The qRT-PCR was performed on ABI StepOne RT-PCR system in which cDNA was used in 10μL reaction with SYBR Premix ExTaq (TaKaRa, Dalian, China) following the manufacture’s procedure. The relative expressions of genes were calculated with 2^-ΔΔCT method by normalizing to the internal control gene β-actin (Accession NO.U60481.1) [36 (link)]. Three replicates were conducted in qRT-PCR analysis, and primer sequences for the analyzed genes were presented in S9 Table. With respect to the validation of transcriptiome data, Pearson’s correlation test was adopted to analyze the correlation significance of genes expression in ABA and NDGA-treated fruits relative to the CK between qRT-PCR and RNA-seq.