Pgex 2tk vector

E. coli strains DH5α and XL-1 blue were used as host cells for cloning and expression of recombinant human RNase L, respectively. The LB-medium and LB-agar plates were supplemented with 100 μg/mL of ampicillin. The pBluescript II SK- (+) vector (Stratagene, U.S.A.) was used for DNA cloning and pGEX 2TK-vector (Amersham, U.S.A.) was used for protein expression. Oligonucleotides were commercially synthesized (Microsynth, Switzerland) and Pfu-DNA polymerase (Finnzymes) was used for PCR amplification of the RNase L cDNA. Glutathione-agarose beads, IPTG, and reagents used for RNase-activity assay were from Sigma Aldrich, USA. The human RNase L cDNA (pZC5) and the 2-5A cofactor [pppA(2′p5′A)₃ (tetramer)] [12 (link)] used in the ribonuclease assay were kind gifts from Professor R. H. Silverman, Cleveland Clinic Foundation, OH.

The hPTHrP1-34 and 1-84 fragments were amplified by RT-PCR from human bony complementary DNA using P1 (5′- TTTCCGGGATCCATGGCTGTGTCTGAACATCAGCT)/P2 (5′- TTTCCGGAATTCTCAAGCTGTGTGGATTTCTGCG) and P3 (5′- TTTCCGGGATCCATGGCTGTGTCTGAACATCAGCT)/P4 (5′- TTTCCGGAATTCTCACTTGAGCGGCTGCTCTTTG) primers, and the resulting product was digested with BamHI and EcoRI (sites underlined) and ligated into the GST fusion vector pGEX-2TK vector (Amersham). The recombinant DNA was used to transform competent E. coli BL21 (DE3) strains. Ampicillin resistance colonies were grown overnight in agar plate containing 50 µg/ml ampicillin, diluted ten times in the same medium, and grown to a concentration of 1 absorbance U/ml (at 600 nm). Expression of hPTHrP1-34 and 1-84 were induced with 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) for 0h, 1h, 2h, 3h or 4h, and the bacterial suspension were harvested. The cells were pelleted, resuspended at 1/20 volume in cold 1×PBS, and sonicated on ice. Total protein from soluble fractions was dissolved in 2×SDS-PAGE buffer (2% SDS, 20% glycerol, 0.001% Bromphenol blue, and 0.125 M Tris-HCl pH 6.8) with subsequent boiling and fractionated by SDS-PAGE.