Seqman pro program

PCR product (198 bp) containing a fragment of TFPI 3′UTR (NM_006287) with miR-27a/b-3p binding site was cloned into pCR 2.1 vector (Life Technologies, Madrid, Spain) using the primers: (5′GAGCTCCGTTATTTTTACCGTGTTTTG and 5′ACGCGTCGTTTGAGTGGTTTTCAG). SacI and MluI were used to digest positive clones (New England Biolabs, Ipswich, MA). The insert was subcloned into luciferase reporter plasmid pMIR-REPORT (Life Technologies, Madrid, Spain) previously digested with these enzymes. A deletion mutant of pMIR-REPORT-TFPI without miR-27a/b-3p seed region-binding site was generated using the primers S: 5′GAGCTCCGTTATTTTTACCGTGTTTTG and AS: 5′ACGCGTCGTTTGAGTGGTTTTCAG with the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA). Insertion of TFPI 3′ UTR fragment and seed sequence deletion was confirmed by sequencing. PCR amplification was performed on plasmid DNA (Platinum Taq High Fidelity, Life Technologies, Madrid, Spain) and cleaned-up using ExoSAP-IT (Affymetrix, Santa Clara, CA). Sequences were performed using the BigDye Terminator Reaction Chemistry v3.1 on Applied Biosystems 3130 XL DNA analyzers (Life Technologies, Madrid, Spain). Alignments and sequence analysis were performed using Seqman Pro program (Lasergene version 7.1, DNASTAR, Madison, WI).

Bisulfite sequencing was used to determine the methylation status of the F/R-BDP region in NO and EOC human tissue samples (Clark et al., 1994 (link)). Genomic DNA was isolated using the Puregene Tissue Kit (QIAGEN) and was chemically converted using the EZ DNA Methylation Kit (Zymo Research Corp.). The F/R-BDP region containing a CGI was amplified from the bisulfite-converted DNA using methylation PCR-specific primers, designed using MethPrimer (Supplementary file 2; Li and Dahiya, 2002 (link)). Gradient PCR reactions were performed using a C1000 Touch Thermal Cycler (Bio-Rad) to optimize annealing temperatures. After gel purification using the QIAquick Gel Extraction Kit (QIAGEN), PCR products were cloned using the TOPO TA Cloning Kit (Invitrogen). Between 9 and 15 individual clones were sequenced for each sample, and Sanger sequencing was performed by the UNMC DNA Sequencing Core Facility. DNA sequence information was analyzed using the Lasergene SeqMan Pro program (DNASTAR).

PCR product (1,060 bp) containing the F11 3′UTR from human genomic DNA (NM_000128), obtained using primers F11-3′UTR_F and F11-3′UTR_R, was cloned into the pCR 2.1 vector (Life Technologies, Madrid, Spain) (Table S3). Positive clones were digested with SpeI and MluI (New England Biolabs, Ipswich, MA) and the insert was subcloned into luciferase reporter plasmid pMIR-REPORT (Life Technologies, Madrid, Spain) previously digested with SpeI and MluI. Insertion of F11 3′UTR was checked by sequencing (ABI3130 XL, Life Technologies Corporation, Carlsbad, CA). All sequence analyses and alignments were performed with the SeqmanPro program (Lasergene version 7.1, DNASTAR, Madison, WI).
To generate mutations in the predicted target site for miR-181a-5p, seven nucleotides (TGAATGT) located in the seed sequence were deleted using the QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA). In silico prediction, using RNAHybrid, of miR-181a-5p binding to the mutated sequence showed a 33% decrease in the minimum free energy value (not shown) indicating that miR-181a-5p: F11 mRNA interaction was completely suppressed. Sequencing was performed to check for the deletion of the seed sequence. The primers used (del_181_AS and Del_181_S) are detailed in Table S3.