Smarter race 5 3

Manufactured by Takara Bio

Sourced in United States

The SMARTer® RACE 5′/3′ is a molecular biology kit used for rapid amplification of cDNA ends (RACE). It enables the generation of full-length cDNA sequences from RNA samples, including the 5' and 3' untranslated regions.

Automatically generated - may contain errors

Lab products found in correlation

Topo ta cloning, by Thermo Fisher Scientific (1 mentions) Alexa fluor 488 secondary antibody, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

SMARTer 5′ RACE and 3′ RACE kit SMARTer RACE 5′/3′ Kit Clontech SMARTer® RACE 5′/3′ Kit SMARTer® RACE 5′/3′Kit User Manual SMARTer Rapid amplification of cDNA ends (RACE) 5′/3′ kit 5′ RACE

6 protocols using smarter race 5 3

Obtaining full-length cDNA of Pv-eng-5 and Pv-eng-8

Check if the same lab product or an alternative is used in the 5 most similar protocols

Race experiments were carried out to obtain the full-length cDNA of Pv-eng-5 and Pv-eng-8 by using 1 μg of total RNA from nematode mixed stages with SMARTer^® RACE 5′/3′ (Clontech, Mountain View, CA, USA) according to the manufacturer’s instructions.
The 3′ end of Pv-eng-5 was amplified using the gene specific primer Pv-eng-5R3′-2 and a long primer UPM (Table 1). Nested PCR, using the short universal primer UPS and either Pv-5DB_for2 or Pv-5DB_for3 specific primers (Table 1), generated two bands which were cloned and sequenced. One band corresponded to Pv-eng-5 and the second band to Pv-eng-8.
The 5′ RACE of Pv-eng-8 was generated, using the gene specific primer Pv-eng-8REV3 and a long UPM (Table 1). Nested PCR, using the short universal primer UPS and gene specific primers: Pv-eng-8-race5′1 and Pv-eng-8-race5′2 (Table 1), generated a band which was cloned and sequenced.

Fanelli E., Troccoli A, & De Luca F. (2018). Functional Variation of Two Novel Cellulases, Pv-eng-5 and Pv-eng-8, and the Heat Shock 90 Gene, Pv-hsp-90, in Pratylenchus vulnus and Their Expression in Response to Different Temperature Stress. International Journal of Molecular Sciences, 20(1), 107.

+ Open protocol

+ Expand

Complete CVTR Genome Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

After the assembly of HTS data, several overlapping primer pairs were designed to validate deep sequencing results by Sanger sequencing. The sequences of the primers used to complete the CVTR genome sequence, are presented in Table S4. The two genome ends were determined by a Rapid Amplification of Complementary DNA Ends (RACE) kit (SMARTer^® RACE 5′/3′, Clontech) according to manufacturer’s instructions [30 (link)]. Briefly, first strand cDNA synthesis carried out by SMARTScribe RT using a modified oligo (dT) primer and SMARTer II A Oligonucleotide. Following reverse transcription, 5′ and 3′ RACE PCR reactions were accomplished using four gene specific primers (GSP for direct PCR and NGSP for nested-PCR) and two universal long and short primers. All amplified fragments were directly sequenced by Iontek, Istanbul, Turkey.

Çağlayan K., Roumi V., Gazel M., Elçi E., Acioğlu M., Mavric Plesko I., Reynard J.S., Maclot F, & Massart S. (2019). Identification and Characterization of a Novel Robigovirus Species from Sweet Cherry in Turkey. Pathogens, 8(2), 57.

+ Open protocol

+ Expand

Determining RAIN Transcript Sequence

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine the sequence of the full RAIN transcripts we perfomed 5΄ RACE and 3΄ RACE using the SMARTer RACE 5′/3′ (Clontech) kit following the manufacturer's instructions. Briefly, 1 μg of DNAse-treated RNA extracted from TPC1 cells has been retro-transcribed to generate 5′ RACE-ready and 3′ RACE-ready cDNA. 5′ ends and 3′ ends of RAIN transcripts have been amplified using the RAIN_RACE_R and RAIN_RACE_F primers respectively (see Supplementary Table SI for sequence) and a touchdown PCR program. Amplified fragments have been extracted from agarose gel, cloned into the pRACE plasmid and sequenced.

Sancisi V., Manzotti G., Gugnoni M., Rossi T., Gandolfi G., Gobbi G., Torricelli F., Catellani F., Faria do Valle I., Remondini D., Castellani G., Ragazzi M., Piana S, & Ciarrocchi A. (2017). RUNX2 expression in thyroid and breast cancer requires the cooperation of three non-redundant enhancers under the control of BRD4 and c-JUN. Nucleic Acids Research, 45(19), 11249-11267.

+ Open protocol

+ Expand

Cloning and Sequencing of Pl-eng-2

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 3′/5′ RACE of Pl-eng-2 was carried out on 1 µg of total RNA from nematode mixed stages with SMARTer^® RACE 5′/3′ (Clontech, California, USA) according to the manufacturer’s instructions. The 3′ end of Pl-eng-2 was amplified using the gene specific primer 3′RACE Pl5 eng 3 (CGTGGATGTGGTGGCGGCGA) and a long universal primer UPM.
Nested PCR, using the short universal primer UPS and 3′RACE Pl5 eng 2 (GCCAGTGTTGTGAAGCCATACC) specific primers, generated a band that was cloned and sequenced.
The 5′ end of Pl-eng-2 was generated using the gene specific primer 5′RACE Pl5 eng 3 (TCGCCGCCACCACATCCACG) and a long UPM. Nested PCR, using the short universal primer UPS and gene specific primers 5′RACE Pl5 eng 2 (GGTATGGCTTCACAACACTGGC), generated a band that was cloned and sequenced. 5′/3′ PCR reactions were performed as follows: 94 °C for 2 min; 30 cycles at 94 °C for 30 sec, 66 °C for 30 s, and 72 °C for 3 min and a final extension step at 72 °C for 7 min.

Mirghasemi N., Fanelli E., Jamali S., Sohani M.M, & De Luca F. (2021). Molecular Characterization of Three B-1,4-Endoglucanase Genes in Pratylenchus loosi and Functional Analysis of Pl-eng-2 Gene. Plants, 10(3), 568.

+ Open protocol

+ Expand

Riboprobe Templates for In Situ Hybridization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Templates for antisense riboprobes for in situ hybridization were amplified by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA libraries or from genomic DNA (see Additional file 1 for details on each sequence). Template sequences were cloned either using TOPO-TA cloning (ThermoFisher) into pCRII dual promoter vector, or using restriction enzyme cloning into pCiProbe (see Additional file 1) linearized NotI-EcoRI. In vitro transcription of labeled riboprobes and two-color fluorescent in situ hybridization were performed as previously described [35 (link)].

Lowe E.K, & Stolfi A. (2018). Developmental system drift in motor ganglion patterning between distantly related tunicates. EvoDevo, 9, 18.

+ Open protocol

+ Expand

Multi-Target Fluorescent In Situ Hybridization for Developmental Biology

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA, or synthesized de novo (Twist Bioscience). See Supporting Information for detailed sequences and sequence IDs to search for further information in the ANISEED database (Dardaillon et al., 2020 (link)). In vitro transcription of labeled probes for fluorescent in situ hybridization was performed as previously described (Ikuta & Saiga, 2007 (link); Stolfi, Lowe, et al., 2014 ). To detect cilia, larvae were incubated with anti-acetylated α-tubulin primary antibody (clone 6-11B-1, Sigma) and AlexaFluor-488 secondary antibody (ThermoFisher) as previously described (Pennati et al., 2015 (link)). Cell outlines were counterstained with phalloidin AlexFluor-546 conjugate (ThermoFisher) incubated 1:50 for at least 2 hours prior to final washes, and nuclei were labeled with DAPI during the final wash. Embryos were imaged on upright and inverted epifluorescence microscopes (Leica), or TCS SP5 AOBS and TCS SP8 X scanning point confocal systems (Leica).

Lowe E.K., Racioppi C., Peyriéras N., Ristoratore F., Christiaen L., Swalla B.J, & Stolfi A. (2020). A cis-regulatory change underlying the motor neuron-specific loss of Ebf expression in immotile tunicate larvae. Evolution & development, 23(2), 72-85.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!