Pcr primers

If not stated otherwise, all chemicals were obtained from Sigma-Aldrich (Taufkirchen,, Germany). PCR primers were purchased from Eurofins MWG Operon (Ebersberg, Germany). The MAPK inhibitors SB 203580 and PD 98059 were purchased from Tocris (Bristol, United Kingdom), and pertussis-toxin from List Biological Laboratories (Campbell, CA, USA). The H₄R-selective antagonist JNJ7777120 (1-[(5-chloro-1H-indol-2-yl) carbonyl]-4-methylperazine) was kindly provided by Dr. Armin Buschauer (University of Regensburg, Germany).

The isolation of RNA, primer design, and determination of gene expression level of p21 by the use of real-time qRT-PCR measurements were accomplished as described prior (Rohrbeck et al. 2012 (link)). The following primer pairs were applied for qRT-PCR: p21/Cdkn1 (NM_007669.4) forward: GTACTTCCTCTGCCCTGCTG; reverse: GGCACTTCAGGGTTTTCTC, B2M (NM_009735.3) forward: ATTCACCCCCACTGAGACTG; reverse: GCTATTTCTTTCTGCGTGCAT. PCR primers were acquired by Eurofins (Ebersberg, Germany).

DNA was isolated from 62 patients with PFAPA syndrome. Peripheral blood (5 mL) for DNA isolation was taken together with blood for routine laboratory work. DNA isolation was performed using the FlexiGene isolation kit (Qiagen, Germany), according to the recommended protocol. DNA was stored at 4°C prior to further molecular analyses.
PCR primers (Eurofins MWG Operon, Germany) were designed according to the established laboratory protocol (sequences are available upon request), covering whole coding regions and intron/exon boundaries of all four genes (MEFV, NLRP3, MVK, and AIM2) including promoter, 5′UTR, and 3′UTR regions of AIM2 gene.

A QIAamp DNA Blood Mini Kit (250) and a DNA ladder (50 bp or 100 bp gene ruler) were purchased from Qiagen, Hilden, Germany. The HotStart-IT^® FideliTaq^TM PCR Master Mix (2X) was purchased from Affymetrix Inc., Santa Clara, CA, USA. FastDigest restriction enzymes were all purchased from Thermo Fisher Scientific Inc., Waltham, MA, USA. The PCR primers were obtained from Eurofins Genomics, Ebersberg, Germany.

The natural DNA phosphoramidites and 8-aza-7-deaza-2´-deoxyguanosine phosphoramidite were purchased from Glen Research. 7-Deaza-2´-deoxyguanosine phosphoramidite was purchased from Chem Genes. The synthetic reagents [activators: 1H-tetrazole, dicyanoimidazole, 5-benzylthio-1H-tetrazole; capping reagents: acetic anhydride, phenoxyacetic anhydride, 1-methylimidiazole; oxidation reagents: iodine, (1S)-(+)-(10-camphorsulfonyl)-oxaziridine; deblocking reagents: dichloroacetic acid; solid support: Glen UnySupport] were all from Glen Research. Anhydrous acetonitrile, molecular sieves 3A, triethylamine, and 3% trichloroacetic acid in dichloromethane were from Fujifilm-Wako. Ammonium hydroxide was from Sigma-Aldrich. Q5 High-Fidelity DNA polymerase and Phusion High-Fidelity DNA polymerase were from New England Biolabs. TaKaRa Ex Taq was from TaKaRa Bio. Indexed adapter oligonucleotides were from Integrated DNA Technologies (IDT). PCR primers were from Eurofins.

Chemicals were obtained from Sigma-Aldrich (Seelze, Germany), Carl Roth (Karlsruhe, Germany), or Merck (Darmstadt, Germany) in p.a. quality. PCR primers were obtained from Eurofins MWG Operon (Ebersberg, Germany).