Takara agarose gel dna purification kit ver 2

In order to determine the nucleotide sequences of the BVDV samples, two sets of common primers for BVDV-1 and BVDV-2 (F1 5′-GCCATGCCCTTAGTAGGACT-3′, and R1 5′-CACCCTATCAGGCTGTRTYC-3′, F2 5′-CTCTGCTGTACATGGCACAT-3′ and R2 5′-GAGCAGCTKGTGACCCATAR-3′) were designed on the basis of the conserved regions of reference strains. The primer pair F1/R1 resulted in a 230-bp fragment of the 5′UTR after amplification whereas the primer pair F2/R2 amplified the product containing entire N^pro region. The PCR amplification was conducted in a total volume of 25 μl containing 12.5 μl Premix Ex Taq (TaKaRa, Dalian, China), 2 μl cDNA, 9.5 μl sterilized H₂O, and 0.5 μM each of the primers. The PCR cycling involved 94°C for 5 min, followed by 30 cycles at 94°C for 45 s, 61°C for 45 s and 72°C for 1 min, with a final elongation step at 72°C for 10 min. The amplified products were analyzed by 1.5% agarose gel electrophoresis. Sixteen samples which represented six counties in Qinghai were chosen from among the 98 positive samples for sequencing. The PCR products were purified with the TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 and were cloned into the pMD-18 T vector (TaKaRa, Dalian, China). The recombinant plasmids were sequenced with the primers M13F and M13R at the Nanjing GenScript Biotech Co., Ltd., Nanjing, China.

HLMLP was identified from expressed sequence tags (ESTs) constructed from a cDNA library of unfed female H. longicornis ticks, as described previously [19 ]. The full-length HLMLP cDNA of H. longicornis was obtained using a 5′ rapid amplification of cDNA ends (RACE) system (TaKaRa, Dalian, China) according to the manufacturer’s instructions. A gene-specific primer (GSP: TGCTCATGGCGCACTCCGTGTTG) was designed from the known 3′ fragment and used in 5′ RACE to amplify and clone the full-length HLMLP cDNA. The full-length sequences of HqMLP, HaMLP, HrMLP, BmMLP, and DsMLP were subsequently PCR-amplified from their respective cDNAs with the universal primers MLP-F (5′-ATGCCTTTCAAGCCCGT-3′) and MLP-R (5′-TTAGCCGTAGGTRGGGTCGTG-3′). The primers used in this study were synthesized by TaKaRa, Dalian, China. The PCR products were purified using a TaKaRa Agarose Gel DNA Purification Kit Ver. 2.0 (TaKaRa, Dalian, China), and the amplified products were ligated into the vector pMD^®19-T (TaKaRa, Dalian, China)). The positive clones were sequenced with vector-specific primers (T7 and SP6) by Sangon (Shanghai, China). All sequences have been submitted to GenBank and can be retrieved with the accession numbers shown in Table 1.

The PCR products of the partial gltA and ompA gene were purified using the TaKaRa Agarose Gel DNA purification Kit Ver.2.0 (TaKaRa, Dalian, China), ligated into pGEM-T Easy vector (Promega, USA), and transformed into Escherichia coli JM109 competent cells. Two recombinant clones were selected for sequencing using BigDye Terminator Mix (Sangon, Shanghai, China). The sequences obtained in this study were deposited in the GenBank (not including identical sequences) under accession nos. KT921891-KT921896. Sequences were analyzed by a BLASTn search in GenBank or by using the Clustal W method in the MegAlign software (DNAStar, Madison, WI). Phylogenetic trees were then based on the sequence distance method using the neighbor-joining (NJ) algorithm with the Kimura two-parameter model of the Mega 4.0 Software [19 (link)].