HEK-293T cells transfected with pHA-Ubiquitination, pEGFP-METTL14, or pMYC-HRD1 were lysed in NP-40 buffer after 48 hpt for Co-IP assay. Cell lysates were processed for western blotting using rabbit anti-METTL14/MYC antibody (Proteintech, China), rabbit anti-HA antibody (Sigma, USA), and rabbit anti-β-actin antibody (ABclonal, China). Additionally, to examine effect of NS5B on HRD1 E3 ligase activity, HEK-293T cells transfected with pHA-Ubiquitination, pEGFP-METTL14, pFlag-NS5B, or pMYC-HRD1 were lysed in NP-40 buffer after 48 hpt for Co-IP assay. Cell lysates were processed for western blotting using rabbit anti-METTL14/MYC antibody (Proteintech, China), rabbit anti-HA antibody (Sigma, USA), and rabbit anti-β-actin antibody (ABclonal, China). For studying polyubiquitination of METTL14, cells transfected with pHis-Ub (WT and -K6, -K11, -K27, -K29, or -K63), pEGFP- METTL14, and pHA-HRD1. At 48 hpt, cells were lysed in NP-40 lysis buffer for the same experiment operation as above. Cell lysates were processed for western blotting using rabbit anti- METTL14/His antibody (Proteintech, China), rabbit anti-HA antibody, and rabbit anti-β-actin antibody.
Rabbit anti ha antibody
Manufactured by Merck Group
Sourced in United States, China
The Rabbit anti-HA antibody is a laboratory reagent used for the detection and identification of proteins tagged with the HA (Hemagglutinin) epitope. This antibody specifically binds to the HA tag, allowing researchers to track and analyze the expression and localization of HA-tagged proteins in various experimental systems.
Automatically generated - may contain errors
Lab products found in correlation
Mouse anti flag antibody, by Merck Group (4 mentions)
Paraformaldehyde (pfa), by Polysciences (4 mentions)
Amt image capture engine v602, by Advanced Microscopy Techniques (4 mentions)
Ultracut uct7 cryo ultramicrotome, by Leica (4 mentions)
1200 ex transmission electron microscope, by JEOL (4 mentions)
H6908, by Merck Group (3 mentions)
Amt 8 megapixel digital camera, by Advanced Microscopy Techniques (3 mentions)
Mouse anti gfp antibody, by Roche (2 mentions)
Anhydrotetracycline atc, by Cayman Chemical (2 mentions)
Rat anti flag antibody, by Novus Biologicals (2 mentions)
Rabbit anti his antibody, by Merck Group (2 mentions)
Restriction enzyme, by New England Biolabs (2 mentions)
Anti rabbit igg antibody conjugated to 18 nm colloidal gold, by Jackson ImmunoResearch (2 mentions)
Colloidal gold conjugated goat anti rabbit igg h l, by Jackson ImmunoResearch (2 mentions)
Glutaraldehyde, by Polysciences (2 mentions)
Protein g sepharose 4 fast flow, by GE Healthcare (2 mentions)
Odyssey clx infrared scanner, by LI COR (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Dynabeads protein g, by Thermo Fisher Scientific (2 mentions)
Lsm 700 confocal microscope, by Zeiss (2 mentions)
35 protocols using rabbit anti ha antibody
1
Investigating METTL14 Ubiquitination by HRD1
2
Immunofluorescence Analysis of Transfected SLK Cells
3
Immunostaining Yeast Chromosome Spreads
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Yeast chromosome spreads were prepared as described (Xaver et al., 2013 (link)). Spread nuclei were stained by anti-myc 9E10 mouse antibody (1:50), followed by anti-mouse cy3-conjugated secondary antibody (Jackson ImmunoResearch, 1:400) for Spp1-myc or Bre2-myc, and with rabbit anti-HA antibody (Sigma, 1:100) followed by anti-rabbit FITC-conjugated antibody (Sigma, 1:500) for Mer2-HA. Immunostained, fixed chromosome spreads were analyzed on a ZEISS AXIO Imager M2, with a ZEISS Plan-Neofluar 100×, aperture: 1.3, and a 2× additional magnification by a Zeiss optovar. Specimens were mounted in Vectashield with 0.2 µg/ml DAPI, and well-spread nuclei were selected based on their DNA-morphology (DAPI). Images were taken at a constant exposure time of 2 s for DAPI (BFP channel), CY3 (CY3 channel), and FITC (FITC channel). Light source: Sola SM II (Lumencor); camera: CoolSNAP HQ2 (Visitron Systems GmbH); acquisition software: Visiview (Visitron Systems GmbH). From these records, the nuclear area, foci numbers and foci areas were determined using Fiji software. Signals were counted as overlaps if foci overlapped by >60% of their diameter.
4
JMJD6 Protein Interactions in HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were transfected at a confluency of 60% with C-terminal HA-tagged JMJD6-2, JMJD6-Ex5 or JMJD6-2-ΔpolyS and GFP-tagged U2AF65, U2AF6520-70 or UBF (26672, Addgene, Watertown, MA, USA) using Lipofectamine 2000 (11668030, Thermo Fisher, Waltham, MA, USA). The same experiment was conducted with HEK293T cells transfected with GFP-tagged JMJD6-2, JMJD6-Ex5 or JMJD6-2-ΔpolyS and Flag-tagged FCP1. Beads with anti-GFP (ABIN509397, ChromoTek, Planegg-Martinsried, Germany) were used for immunoprecipitation as described in Webby et al. (2009) [6 (link)]. Western blots were stained with mouse anti-GFP antibody (11814460001, Roche, Basel, Switzerland), rabbit anti-HA antibody (H6908, Sigma Aldrich, St. Louis, MO, USA) and mouse anti-Flag antibody (F1804, Sigma Aldrich, St. Louis, MO, USA).
5
Immunofluorescence of Embryonic Mouse Brains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E18.5 mouse brains were fixed in 4% PFA at 4°C overnight as previously described
[49 (link)]. Brains were cryoprotected in
30% sucrose and frozen in the Optimum Cutting Temperature embedding medium. Then
16 µm sections were prepared using a Leica CM1900 cryostat. Sections were
blocked with 0.1% Triton X-100 and 10% horse serum in 1× PBS for 1 h at room
temperature. Sections were then incubated overnight with rabbit anti-HA antibody
1:400 (Sigma) and anti-CDH13 1:300 (In Vitro Technologies) at 4°C. Slices were
then washed three times with PBS and incubated with secondary donkey anti-rabbit
Alexa 594 and anti-chicken 488 (Jackson ImmunoResearch) antibodies for 2 h at
room temperature. Slides were mounted in Prolong™ Gold Antifade with DAPI
(Invitrogen #P36931), and the images were acquired on a Nikon Eclipse Ti
microscope and Nikon Digital Sight DS-Qi1 camera at 20×.
[49 (link)]. Brains were cryoprotected in
30% sucrose and frozen in the Optimum Cutting Temperature embedding medium. Then
16 µm sections were prepared using a Leica CM1900 cryostat. Sections were
blocked with 0.1% Triton X-100 and 10% horse serum in 1× PBS for 1 h at room
temperature. Sections were then incubated overnight with rabbit anti-HA antibody
1:400 (Sigma) and anti-CDH13 1:300 (In Vitro Technologies) at 4°C. Slices were
then washed three times with PBS and incubated with secondary donkey anti-rabbit
Alexa 594 and anti-chicken 488 (Jackson ImmunoResearch) antibodies for 2 h at
room temperature. Slides were mounted in Prolong™ Gold Antifade with DAPI
(Invitrogen #P36931), and the images were acquired on a Nikon Eclipse Ti
microscope and Nikon Digital Sight DS-Qi1 camera at 20×.
6
Immunoprecipitation and Detection of Stu2-HA and SUMO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Yeast whole‐cell extracts were prepared as described above by bead beating. Extracts were incubated with agarose anti‐HA beads (cat# A2095, Sigma Aldrich, St. Louis, MO,) at 4 °C on a rotisserie for 2 hr. Beads were collected and washed twice with ice‐cold PBS containing an additional 0.5 M NaCl, for a total of 650 mM NaCl. To elute, beads were boiled with 3x Laemmli sample buffer for 5 min. Stu2‐HA was detected using rabbit anti‐HA antibody (Sigma Aldrich, St. Louis, MO, Cat #H6908) at 1:1500 in PBS for 2 hr at RT. SUMO was detected using rabbit anti‐Smt3p (Rockland, Inc. Gilbertsville, PA, Cat #200–401‐428) at 1:1000 in PBS for 2 hr at RT.
7
Cloning and Expression of Hap Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hap gene and its upstream 500 bp region, was amplified by PCR with Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) using NTHi375 genomic DNA as template, and primers hap-F1 (5´-ACTATCGTCGTCATTGAACACAATCTTGAT )/hap-R1 (5´-TTAAGCGTAGTCTGGGACGTCGTATGGGTACCAACGATACCCCAATTTCACGCCCAC ). The hap-R1 reverse primer was used to introduce an HA tag coding sequence at the 3´end of the hap gene. This 4,677 bp blunt PCR product was phosphorylated with T4 kinase (New England Biolabs), and cloned into pSU20 [32 (link)], previously digested with HincII and dephosphorylated with antarctic phosphatase (New England Biolabs), generating pSU20-Pr::hapNTHi375-HA. pSU20 and pSU20-Pr::hapNTHi375-HA were transformed into electrocompetent Hi RdKW20. Transformations were selected on sBHI-agar with Cm1. Hi RdKW20, RdKW20 (pSU20) and RdKW20 (pSU20-Pr::hapNTHi375-HA) whole cell extracts were prepared from cultures grown to OD600 = 0.9 in sBHI containing Cm1, when required. HapNTHi375-HA expression was analyzed by western blot with a primary rabbit anti-HA antibody (Sigma) diluted 1:4000, and a secondary goat anti-rabbit IgG (whole molecule, Sigma) antibody conjugated to horseradish peroxidase, diluted 1:1000.
8
Meiotic Co-immunoprecipitation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Co-immunoprecipitation from meiotic culture was performed as described in de los Santos and Hollingsworth (1999) (link). In brief, 2 × 10^9 cells were collected at 4 hr in SPM and ruptured using a multibead shocker (YASUI-KIKAI, Osaka) at 2500 rpm, 15 cycles of 30 s on and 30 s off, at 4°C. Extracts were then sonicated using a Covaris S2 (duty cycle: 15%; intensity: 10.0; cycles/burst: 500; total time: 240 s). After removing the cell debris by centrifugation, Benzonase (20 U/sample, Sigma) as well as anti-SV5-coated magnetic beads (50 µl Pan mouse IgG, Dynabeads) were added, followed by rotating incubation for 3 hr at 4°C. Rabbit anti-HA antibody (Sigma, 1:1000) and anti-rabbit horseradish peroxidase-conjugated antibody (Pierce, 1:10,000) were used for detection.
9
Western Blot Analysis of Worm Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Worm lysates were prepared by sonication, followed by centrifugation at 10000×g at 4°C to eliminate the debris. The clarified protein samples mixed with an equivalent volume of protein sample buffer and subsequently denatured at 95°C for 10 min. The denatured protein samples were subjected to electrophoresis using a 4–20% SDS-PAGE gel (Bio-Rad) in running buffer and subsequently transferred onto polyvinylidene difluoride (PVDF) membranes in transferring buffer. Primary antibodies used in this study were rabbit anti-HA antibody (Sigma, H6908) and rabbit anti-Actin antibody (Sigma, A2066) at 1:1000 dilution. The secondary antibody was goat anti-rabbit IgG at 1:5000 dilution (GE Healthcare). Biotinylated proteins were blotted using HRP-conjugated Streptavidin at 1:1000 dilution (Thermo, N100). Images were acquired using a chemiluminescence imaging system (Syngene).
10
Mammalian Protein Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All primers were obtained from Integrated DNA Technologies. A list of primers used in this study can be found in Table S1 in the supplemental material. Restriction enzymes were purchased from New England Biolabs. HisTrap magnetic Sepharose beads were from Cytiva. The Expi293 cells, transfection reagent ExpiFectamine, blasticidin S HCl, Ni-nitrilotriacetic acid (NTA) beads, mouse anti-HA antibody-coated magnetic beads, and rabbit anti-V5 antibody were from Thermo Fisher. The rat anti-FLAG antibody was from Novus Biologicals; the rabbit anti-HA antibody, the rabbit anti-His antibody, and rapamycin were from Sigma. The mouse anti-PM V antibody was previously described (31 (link)). Anhydrotetracycline (aTc) was purchased from Cayman Chemical. DSM-1 was from Asinex.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!