Mirna mimic inhibitor

Cells were starved for 24 h before the various treatments. When cells approach 70% confluence, they were transfected with 100 nM siRNA, or the miRNA mimic/inhibitor (Ribobio, Guangzhou, China). To achieve a final concentration of 100 nM, siRNA or the miRNA mimic/inhibitor was diluted with the transfection buffer and reagent complexes (Ribobio, Guangzhou, China) according to the manufacturer's instructions. The OGD/R model was constructed 48 h after transfection. Ribobio lncRNA smart silencer for lncRNA Ier2 is a pool containing three siRNA and three antisense oligonucleotides：

>siRNA-1target sequence：ACCCGAAGCTGCAATGGAA;

>siRNA-2target sequence：CCAGCGAATTTAAGAAAGT;

>siRNA-3target sequence: GTCCACAGGTGCTATTAAA;

>antisense oligonucleotides target sequence-1：CCAGCGAATTTAAGAAAGTC;

>antisense oligonucleotides target sequence-2：GAATCTCAGGGTCGGACTCT;

>antisense oligonucleotides target sequence-3：AACCCGAAGCTGCAATGGAA; si-TSPO：GCCACCATGCTAACTACT.

For RNA interference/overexpression and miRNA mimic/inhibitor analyses, primary human chondrocytes or synoviocytes were seeded in six-well plates and allowed to grow to 80% confluence. The cells were then transfected with an homo sapiens (hsa) miRNA mimic/inhibitor (RiboBio, PR China), siRNA (Gene Pharma, PR China), or overexpression plasmid (Vigene Bioscience, PR China) using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s instructions. The properties of the plasmid vectors are listed in Figure S1. Nonspecific hsa-miRNAs (mimic negative control [NC] and inhibitor NC), NC siRNA oligos, and a plasmid with a scrambled sequence were used as NCs. Cells were harvested after 24 h for qRT-PCR or after 48 h for western blot analysis. The specific siRNA sequences used in the study are listed in Table S1.