Evagreen qpcr mix plus rox

Quantitative real-time polymerase chain reaction (qPCR)
was undertaken in an ABI StepOne™ (Applied Biosystems,
Foster City, CA, USA) machine. The expression of ANRIL
at the transcript level was examined by using specific
primers (F: GCCTCATTCTGATTCAACAGCAGAG, R:
CACCTAACAGTGATGCTTGAACCC, final concentration
of 4 pmol/µl for each one), 10 ng of cDNA template and
5X EvaGreen® qPCR Mix Plus (ROX) (Solis BioDyne,
Estonia) in a final reaction volume of 20 µl. The thermal
cycling conditions were an initial denaturation at 95°C
for 10 minutes, followed by 40 cycles of denaturation at
95°C for 15 seconds, annealing at 60°C for 30 seconds and
extension at 72°C for 30 seconds. Poly acrylamide gel
electrophoresis and dissociation curve analysis was used
to verify the specificity of the PCR product. To normalize
the expression of ANRIL, ACTB:F: AGCCTTCCTTCCTGGGCATGG,
R: AGCACTGTGTTGGCGTACAGGTC
was used as an internal control. All of the samples were runin triplicate and the normalized expression levels were usedfor further analysis. The level of differential expression was
calculated by the 2^-ΔΔCt method (12 (link)).

Total RNA purification was performed with the RNeasy kit (Qiagen) and cDNA was generated using QuantiTect Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions. 500 ng of total RNA was used to generate cDNA. Quantitative polymerase chain reaction (qPCR) was performed using 5× HOT FIREPol EvaGreen qPCR Mix Plus (ROX) (Solis Biodyne) on an AriaMX instrument (Agilent). Three step amplification was performed (95 °C for 15 s, 60 °C for 20 s, 72 °C for 30 s) for 45 cycles. Relative expression levels were normalised to Gapdh expression according to the formula 2^- (Ct gene of interest – Ct Gapdh). Fold increase in expression levels were calculated by comparative Ct method 2^-(ddCt). Heatmaps were generated from standardised values of 2^(-ddCt). Statistical analysis was calculated between dCt values. Primer assays used are listed in Supplementary Table 2.

Copied DNA (cDNA) was synthesized through reverse transcription of RNA with Random Hexamer primers (MWG, Fraunhoferstr. 22 D-82152 Martinsried, Germany) and Oligo dT through RevertAid^™ M-MuLV RT (Fermentas, Lithuania) as per manufacturer’s guidelines. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) for selected gene expression through Step One Applied Biosystems PCR system (Applied Biosystem/MDS SCIEX, Foster City, CA, USA) was performed by using Primer set for each of FoxP3 [26 (link)]. Complement of differentiation (CD4, CD25) [27 (link)], IL10 were analyzed, and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) [28 (link)] was used as an internal control. The final reaction volume of 20 μL containing 4 μL of 5X EvaGreen^® qPCR Mix Plus (ROX) (Solis BioDyne, Teaduspargi 9, 50411 Tartu, Estonia), 10 ng of cDNA template, and 4 pM of each forward and reverse primers. The entire samples were run in triplicate, and the normalized expression was used for data analysis. Determination of normalized expression and calculation of ΔCt values were done by subtracting the average Ct value of GAPDH from the average Ct value of IL-10, CD4, CD25, and FoxP3. Relative expression was calculated by 2^−ΔΔCt formula as described [29 (link)]. The thermal reaction conditions are shown in Table 1.